Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627801_at:

>probe:Drosophila_2:1627801_at:440:535; Interrogation_Position=1020; Antisense; GGTGCCCAGCTACGAGCAAATCCTG
>probe:Drosophila_2:1627801_at:627:87; Interrogation_Position=1064; Antisense; AGTCCTACGGATTCTTTGCCAGCTA
>probe:Drosophila_2:1627801_at:458:701; Interrogation_Position=1094; Antisense; TTTTCCCCACTGTTAGCCAGGACAA
>probe:Drosophila_2:1627801_at:678:103; Interrogation_Position=1124; Antisense; AGACCGCCGACAACAACCTGGAGAA
>probe:Drosophila_2:1627801_at:680:551; Interrogation_Position=1143; Antisense; GGAGAACTTCAAGGACGCCGATTTT
>probe:Drosophila_2:1627801_at:248:75; Interrogation_Position=1154; Antisense; AGGACGCCGATTTTGCCAAGCAGAA
>probe:Drosophila_2:1627801_at:133:407; Interrogation_Position=1205; Antisense; GACTGGCGGATACGCTGCGCTACAC
>probe:Drosophila_2:1627801_at:686:381; Interrogation_Position=1243; Antisense; GAACGCGCTGGTGTCTTGGATTGAA
>probe:Drosophila_2:1627801_at:181:243; Interrogation_Position=805; Antisense; AATATGCTGTTCAAGTACGACGGAG
>probe:Drosophila_2:1627801_at:35:45; Interrogation_Position=856; Antisense; ATCGACTTCCAGTTGAGCGTGTGGG
>probe:Drosophila_2:1627801_at:344:347; Interrogation_Position=890; Antisense; GCATCGACCTCAACTATTTCTTCTA
>probe:Drosophila_2:1627801_at:193:19; Interrogation_Position=905; Antisense; ATTTCTTCTACACTAGCCTGACATT
>probe:Drosophila_2:1627801_at:342:219; Interrogation_Position=932; Antisense; AAGTGCTGCGTCATCGGCGGACCCA
>probe:Drosophila_2:1627801_at:269:183; Interrogation_Position=988; Antisense; AAAACGCTGCTCGACCTGGACATGG

Paste this into a BLAST search page for me
GGTGCCCAGCTACGAGCAAATCCTGAGTCCTACGGATTCTTTGCCAGCTATTTTCCCCACTGTTAGCCAGGACAAAGACCGCCGACAACAACCTGGAGAAGGAGAACTTCAAGGACGCCGATTTTAGGACGCCGATTTTGCCAAGCAGAAGACTGGCGGATACGCTGCGCTACACGAACGCGCTGGTGTCTTGGATTGAAAATATGCTGTTCAAGTACGACGGAGATCGACTTCCAGTTGAGCGTGTGGGGCATCGACCTCAACTATTTCTTCTAATTTCTTCTACACTAGCCTGACATTAAGTGCTGCGTCATCGGCGGACCCAAAAACGCTGCTCGACCTGGACATGG

Full Affymetrix probeset data:

Annotations for 1627801_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime