FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627803_at:

>probe:Drosophila_2:1627803_at:531:481; Interrogation_Position=452; Antisense; GTATCCTGGGTTTGCGACGGCGAAC
>probe:Drosophila_2:1627803_at:715:193; Interrogation_Position=474; Antisense; AACTGCTGGCCTCCGTTAGCGATGA
>probe:Drosophila_2:1627803_at:484:445; Interrogation_Position=494; Antisense; GATGACTTCACCTGCAGATTCTGGA
>probe:Drosophila_2:1627803_at:547:367; Interrogation_Position=538; Antisense; GAATGTCATAACCTTTGGCCTGTCC
>probe:Drosophila_2:1627803_at:268:585; Interrogation_Position=568; Antisense; TGGAATGTCCGTCAAGAGTCACCCC
>probe:Drosophila_2:1627803_at:262:209; Interrogation_Position=659; Antisense; AAGCAGACAGTCATCTCCGTGGAGT
>probe:Drosophila_2:1627803_at:519:89; Interrogation_Position=757; Antisense; AGATGTGGTTACCTGGGACCTGAAC
>probe:Drosophila_2:1627803_at:261:681; Interrogation_Position=788; Antisense; TATGTGCCCGCGGATGTCAAGCAGG
>probe:Drosophila_2:1627803_at:707:207; Interrogation_Position=806; Antisense; AAGCAGGTCCACGAGGATTGCGGCC
>probe:Drosophila_2:1627803_at:500:63; Interrogation_Position=863; Antisense; ATGGTTATCGCCATGGTCATCGGGC
>probe:Drosophila_2:1627803_at:573:609; Interrogation_Position=888; Antisense; TGACTCTCAAAGTGTTCGCGGCCAA
>probe:Drosophila_2:1627803_at:176:589; Interrogation_Position=930; Antisense; TGGAGGCCTCCCTGAAATCCTATGG
>probe:Drosophila_2:1627803_at:139:351; Interrogation_Position=967; Antisense; GCACCAGCGATTGCCGTACATTAGT
>probe:Drosophila_2:1627803_at:268:717; Interrogation_Position=997; Antisense; TTCCGATAGGAAACTGCTCTTCTGG

Paste this into a BLAST search page for me
GTATCCTGGGTTTGCGACGGCGAACAACTGCTGGCCTCCGTTAGCGATGAGATGACTTCACCTGCAGATTCTGGAGAATGTCATAACCTTTGGCCTGTCCTGGAATGTCCGTCAAGAGTCACCCCAAGCAGACAGTCATCTCCGTGGAGTAGATGTGGTTACCTGGGACCTGAACTATGTGCCCGCGGATGTCAAGCAGGAAGCAGGTCCACGAGGATTGCGGCCATGGTTATCGCCATGGTCATCGGGCTGACTCTCAAAGTGTTCGCGGCCAATGGAGGCCTCCCTGAAATCCTATGGGCACCAGCGATTGCCGTACATTAGTTTCCGATAGGAAACTGCTCTTCTGG

Full Affymetrix probeset data:

Annotations for 1627803_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720