Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627806_at:

>probe:Drosophila_2:1627806_at:359:459; Interrogation_Position=2952; Antisense; GATTTCCATACAGCTCAATGAGTCA
>probe:Drosophila_2:1627806_at:608:57; Interrogation_Position=2969; Antisense; ATGAGTCATAACATCCGCGGACGGA
>probe:Drosophila_2:1627806_at:263:633; Interrogation_Position=2982; Antisense; TCCGCGGACGGACTGTGTACATAAG
>probe:Drosophila_2:1627806_at:15:153; Interrogation_Position=3000; Antisense; ACATAAGTGTCAAAAAGCTGCTGGC
>probe:Drosophila_2:1627806_at:298:207; Interrogation_Position=3014; Antisense; AAGCTGCTGGCCCTTATCGATCCAT
>probe:Drosophila_2:1627806_at:202:637; Interrogation_Position=3030; Antisense; TCGATCCATTGGCATTCAGAGAGTA
>probe:Drosophila_2:1627806_at:347:205; Interrogation_Position=3065; Antisense; AAGCCCAATCACGATTTGTTCGATA
>probe:Drosophila_2:1627806_at:290:153; Interrogation_Position=3106; Antisense; ACAGGAGACACAGAATCGATTGGTT
>probe:Drosophila_2:1627806_at:713:637; Interrogation_Position=3121; Antisense; TCGATTGGTTCGTTTCCTGGAGGAT
>probe:Drosophila_2:1627806_at:182:465; Interrogation_Position=3223; Antisense; GATTGAGCGTCCAGACTGCCATAAA
>probe:Drosophila_2:1627806_at:421:705; Interrogation_Position=3295; Antisense; TTACAACTATTGTTCTTTTCATGGG
>probe:Drosophila_2:1627806_at:146:65; Interrogation_Position=3382; Antisense; ATGGTCTTTTGACTCAGGTAAACTA
>probe:Drosophila_2:1627806_at:293:389; Interrogation_Position=3450; Antisense; GAAAAAATCGTGTGCTCTTGAGTAT
>probe:Drosophila_2:1627806_at:723:167; Interrogation_Position=3486; Antisense; AAATGTTTTGGCAACGCTTCAGAAA

Paste this into a BLAST search page for me
GATTTCCATACAGCTCAATGAGTCAATGAGTCATAACATCCGCGGACGGATCCGCGGACGGACTGTGTACATAAGACATAAGTGTCAAAAAGCTGCTGGCAAGCTGCTGGCCCTTATCGATCCATTCGATCCATTGGCATTCAGAGAGTAAAGCCCAATCACGATTTGTTCGATAACAGGAGACACAGAATCGATTGGTTTCGATTGGTTCGTTTCCTGGAGGATGATTGAGCGTCCAGACTGCCATAAATTACAACTATTGTTCTTTTCATGGGATGGTCTTTTGACTCAGGTAAACTAGAAAAAATCGTGTGCTCTTGAGTATAAATGTTTTGGCAACGCTTCAGAAA

Full Affymetrix probeset data:

Annotations for 1627806_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime