FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627807_at:

>probe:Drosophila_2:1627807_at:51:35; Interrogation_Position=1354; Antisense; ATCAGTTTCTAGATCGTTGCTCCAT
>probe:Drosophila_2:1627807_at:720:3; Interrogation_Position=1449; Antisense; ATTGTTATTCCTGCTACTGCTGCTA
>probe:Drosophila_2:1627807_at:479:669; Interrogation_Position=1463; Antisense; TACTGCTGCTACTTACTGCTCACTA
>probe:Drosophila_2:1627807_at:178:273; Interrogation_Position=1522; Antisense; CATACACCCTACTTCATTTTCTAAA
>probe:Drosophila_2:1627807_at:43:671; Interrogation_Position=1550; Antisense; TATCCACAAAAGTGTTGCCGGGCTT
>probe:Drosophila_2:1627807_at:154:469; Interrogation_Position=1563; Antisense; GTTGCCGGGCTTTCCAAATCTAGAA
>probe:Drosophila_2:1627807_at:22:531; Interrogation_Position=1656; Antisense; GGGATTCAATGGGACTGTACCTCTT
>probe:Drosophila_2:1627807_at:625:143; Interrogation_Position=1669; Antisense; ACTGTACCTCTTGCATTCATTGTGT
>probe:Drosophila_2:1627807_at:488:355; Interrogation_Position=1694; Antisense; GCACTTGCTTCTTTGCATCTTGAAG
>probe:Drosophila_2:1627807_at:235:373; Interrogation_Position=1718; Antisense; GAAGTGCATCTGTATCTCATTTACT
>probe:Drosophila_2:1627807_at:434:609; Interrogation_Position=1742; Antisense; TGAGCTTCCATGGTACAGTCACCAC
>probe:Drosophila_2:1627807_at:346:201; Interrogation_Position=1771; Antisense; AACGCCCCGCGGTATGCAACAGTAT
>probe:Drosophila_2:1627807_at:252:483; Interrogation_Position=1792; Antisense; GTATTTCTGTGCTTTGTATATGCCA
>probe:Drosophila_2:1627807_at:85:313; Interrogation_Position=1833; Antisense; GCCACTTCTGTTTTGCATGTCGAAA

Paste this into a BLAST search page for me
ATCAGTTTCTAGATCGTTGCTCCATATTGTTATTCCTGCTACTGCTGCTATACTGCTGCTACTTACTGCTCACTACATACACCCTACTTCATTTTCTAAATATCCACAAAAGTGTTGCCGGGCTTGTTGCCGGGCTTTCCAAATCTAGAAGGGATTCAATGGGACTGTACCTCTTACTGTACCTCTTGCATTCATTGTGTGCACTTGCTTCTTTGCATCTTGAAGGAAGTGCATCTGTATCTCATTTACTTGAGCTTCCATGGTACAGTCACCACAACGCCCCGCGGTATGCAACAGTATGTATTTCTGTGCTTTGTATATGCCAGCCACTTCTGTTTTGCATGTCGAAA

Full Affymetrix probeset data:

Annotations for 1627807_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720