FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627808_at:

>probe:Drosophila_2:1627808_at:627:545; Interrogation_Position=113; Antisense; GGATCGGCCTCCTGAAGCTGATGCA
>probe:Drosophila_2:1627808_at:531:207; Interrogation_Position=127; Antisense; AAGCTGATGCAACTGGGCCTGGCCA
>probe:Drosophila_2:1627808_at:598:165; Interrogation_Position=292; Antisense; AAATCCTACAGTCTCATTCGGCAGT
>probe:Drosophila_2:1627808_at:524:715; Interrogation_Position=308; Antisense; TTCGGCAGTCACTATTCGAGACCTT
>probe:Drosophila_2:1627808_at:416:425; Interrogation_Position=325; Antisense; GAGACCTTGTTCAATGGCCTCGCCA
>probe:Drosophila_2:1627808_at:689:283; Interrogation_Position=351; Antisense; CTGCATGTACTTCAGCTCATCCAGT
>probe:Drosophila_2:1627808_at:316:47; Interrogation_Position=369; Antisense; ATCCAGTTACATGGGTTTCGCCTGC
>probe:Drosophila_2:1627808_at:286:519; Interrogation_Position=394; Antisense; GTGGTATGGCTACATCCGCAGTTCC
>probe:Drosophila_2:1627808_at:359:543; Interrogation_Position=430; Antisense; GGATTCTGGGCATATCCGGCCATGA
>probe:Drosophila_2:1627808_at:480:577; Interrogation_Position=447; Antisense; GGCCATGACAGCCTGCTATTACATG
>probe:Drosophila_2:1627808_at:188:565; Interrogation_Position=484; Antisense; GGAATATTGCATGCCCTGGATGCCT
>probe:Drosophila_2:1627808_at:576:11; Interrogation_Position=55; Antisense; ATTCGGATATGCTGTTGTCGCGTCT
>probe:Drosophila_2:1627808_at:86:641; Interrogation_Position=77; Antisense; TCTGCACCTGCATCAATTTCGGGTT
>probe:Drosophila_2:1627808_at:88:19; Interrogation_Position=92; Antisense; ATTTCGGGTTCGTTCTGTCGCGGAT

Paste this into a BLAST search page for me
GGATCGGCCTCCTGAAGCTGATGCAAAGCTGATGCAACTGGGCCTGGCCAAAATCCTACAGTCTCATTCGGCAGTTTCGGCAGTCACTATTCGAGACCTTGAGACCTTGTTCAATGGCCTCGCCACTGCATGTACTTCAGCTCATCCAGTATCCAGTTACATGGGTTTCGCCTGCGTGGTATGGCTACATCCGCAGTTCCGGATTCTGGGCATATCCGGCCATGAGGCCATGACAGCCTGCTATTACATGGGAATATTGCATGCCCTGGATGCCTATTCGGATATGCTGTTGTCGCGTCTTCTGCACCTGCATCAATTTCGGGTTATTTCGGGTTCGTTCTGTCGCGGAT

Full Affymetrix probeset data:

Annotations for 1627808_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720