FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627809_at:

>probe:Drosophila_2:1627809_at:255:457; Interrogation_Position=1002; Antisense; GATACCGCAGAGCATTCTGGCCAAG
>probe:Drosophila_2:1627809_at:278:199; Interrogation_Position=1063; Antisense; AACGACAACCTGCTGGTTTATGCCT
>probe:Drosophila_2:1627809_at:75:667; Interrogation_Position=1096; Antisense; TACATGATGCACTTCTCCAGCGATG
>probe:Drosophila_2:1627809_at:231:445; Interrogation_Position=1117; Antisense; GATGACCTCACCTTGAATCGTGATG
>probe:Drosophila_2:1627809_at:339:343; Interrogation_Position=1151; Antisense; GCTTCAGTATGACTTACCGCCAGAG
>probe:Drosophila_2:1627809_at:304:133; Interrogation_Position=1166; Antisense; ACCGCCAGAGGAATTCGCTACTTTA
>probe:Drosophila_2:1627809_at:243:451; Interrogation_Position=606; Antisense; GATCGTAACCCAGCTGGAAGGTCCA
>probe:Drosophila_2:1627809_at:469:561; Interrogation_Position=621; Antisense; GGAAGGTCCACCAGCGAATAGCCGA
>probe:Drosophila_2:1627809_at:173:37; Interrogation_Position=698; Antisense; ATCTAAGGGACATCTTTGCCTCGCA
>probe:Drosophila_2:1627809_at:484:9; Interrogation_Position=790; Antisense; ATTCGCAGCTTCAACTTTCAGACTT
>probe:Drosophila_2:1627809_at:66:415; Interrogation_Position=819; Antisense; GACCAGCAACTATATGCCTGACTTG
>probe:Drosophila_2:1627809_at:444:313; Interrogation_Position=877; Antisense; GCCAGCATGATCGAATACTCCTTTA
>probe:Drosophila_2:1627809_at:138:251; Interrogation_Position=903; Antisense; CAAGTTTTCAATGTCGGTGCAGTCG
>probe:Drosophila_2:1627809_at:281:549; Interrogation_Position=987; Antisense; GGAGGACTACTTGATGATACCGCAG

Paste this into a BLAST search page for me
GATACCGCAGAGCATTCTGGCCAAGAACGACAACCTGCTGGTTTATGCCTTACATGATGCACTTCTCCAGCGATGGATGACCTCACCTTGAATCGTGATGGCTTCAGTATGACTTACCGCCAGAGACCGCCAGAGGAATTCGCTACTTTAGATCGTAACCCAGCTGGAAGGTCCAGGAAGGTCCACCAGCGAATAGCCGAATCTAAGGGACATCTTTGCCTCGCAATTCGCAGCTTCAACTTTCAGACTTGACCAGCAACTATATGCCTGACTTGGCCAGCATGATCGAATACTCCTTTACAAGTTTTCAATGTCGGTGCAGTCGGGAGGACTACTTGATGATACCGCAG

Full Affymetrix probeset data:

Annotations for 1627809_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720