Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627812_s_at:

>probe:Drosophila_2:1627812_s_at:126:511; Interrogation_Position=198; Antisense; GTGTACGTGGGAAACCTGGGCTCCT
>probe:Drosophila_2:1627812_s_at:690:639; Interrogation_Position=222; Antisense; TCGGCGTCCAAGCACGAGATAGAAG
>probe:Drosophila_2:1627812_s_at:188:27; Interrogation_Position=240; Antisense; ATAGAAGGCGCATTTGCCAAATATG
>probe:Drosophila_2:1627812_s_at:593:19; Interrogation_Position=251; Antisense; ATTTGCCAAATATGGACCCCTGCGA
>probe:Drosophila_2:1627812_s_at:200:25; Interrogation_Position=260; Antisense; ATATGGACCCCTGCGAAACGTGTGG
>probe:Drosophila_2:1627812_s_at:243:361; Interrogation_Position=292; Antisense; GCAATCCACCAGGTTTCGCCTTTGT
>probe:Drosophila_2:1627812_s_at:657:265; Interrogation_Position=301; Antisense; CAGGTTTCGCCTTTGTCGAATTTGA
>probe:Drosophila_2:1627812_s_at:12:637; Interrogation_Position=316; Antisense; TCGAATTTGAGGATCGCCGTGACGC
>probe:Drosophila_2:1627812_s_at:147:105; Interrogation_Position=344; Antisense; AGACGCAACGCGTGCCCTGGACGGA
>probe:Drosophila_2:1627812_s_at:135:507; Interrogation_Position=355; Antisense; GTGCCCTGGACGGAACACGCTGCTG
>probe:Drosophila_2:1627812_s_at:3:387; Interrogation_Position=367; Antisense; GAACACGCTGCTGCGGCACTAGGAT
>probe:Drosophila_2:1627812_s_at:699:331; Interrogation_Position=379; Antisense; GCGGCACTAGGATTCGCGTAGAGAT
>probe:Drosophila_2:1627812_s_at:48:487; Interrogation_Position=396; Antisense; GTAGAGATGTCTTCGGGTCGCTCGC
>probe:Drosophila_2:1627812_s_at:472:83; Interrogation_Position=447; Antisense; AGTAGTGGTCGCTCTGGTTCCGGAC

Paste this into a BLAST search page for me
GTGTACGTGGGAAACCTGGGCTCCTTCGGCGTCCAAGCACGAGATAGAAGATAGAAGGCGCATTTGCCAAATATGATTTGCCAAATATGGACCCCTGCGAATATGGACCCCTGCGAAACGTGTGGGCAATCCACCAGGTTTCGCCTTTGTCAGGTTTCGCCTTTGTCGAATTTGATCGAATTTGAGGATCGCCGTGACGCAGACGCAACGCGTGCCCTGGACGGAGTGCCCTGGACGGAACACGCTGCTGGAACACGCTGCTGCGGCACTAGGATGCGGCACTAGGATTCGCGTAGAGATGTAGAGATGTCTTCGGGTCGCTCGCAGTAGTGGTCGCTCTGGTTCCGGAC

Full Affymetrix probeset data:

Annotations for 1627812_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime