Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627813_at:

>probe:Drosophila_2:1627813_at:280:563; Interrogation_Position=1138; Antisense; GGCAAACAACGTCTGCTAACACTTT
>probe:Drosophila_2:1627813_at:701:653; Interrogation_Position=1154; Antisense; TAACACTTTTTAGACTTCCCCTCAG
>probe:Drosophila_2:1627813_at:308:403; Interrogation_Position=1166; Antisense; GACTTCCCCTCAGTAATAGTCTGGA
>probe:Drosophila_2:1627813_at:89:243; Interrogation_Position=1228; Antisense; AATATAACCAGATCGGCTACCACCG
>probe:Drosophila_2:1627813_at:556:131; Interrogation_Position=1249; Antisense; ACCGATCCCAAAGCGGAGCATTTTA
>probe:Drosophila_2:1627813_at:25:623; Interrogation_Position=1304; Antisense; TGCGGTTTGCCGAGTATCACATTGA
>probe:Drosophila_2:1627813_at:435:613; Interrogation_Position=1326; Antisense; TGAACGGGCCTATCTACTGCACGAA
>probe:Drosophila_2:1627813_at:337:361; Interrogation_Position=1348; Antisense; GAATTGGCCCAAGAGCATCTGAATT
>probe:Drosophila_2:1627813_at:484:681; Interrogation_Position=1445; Antisense; TATGGAGCTTTCTGAGTCTCATGGT
>probe:Drosophila_2:1627813_at:307:541; Interrogation_Position=1467; Antisense; GGTTATATGCAAGGCCCACGCGATT
>probe:Drosophila_2:1627813_at:671:309; Interrogation_Position=1482; Antisense; CCACGCGATTCTCGGCAAGATCGAA
>probe:Drosophila_2:1627813_at:117:429; Interrogation_Position=1516; Antisense; GAGATTCTGGCCGAAGCCTTCGAGC
>probe:Drosophila_2:1627813_at:110:381; Interrogation_Position=1557; Antisense; GAACCTTGACCTGTGCTTATTCATA
>probe:Drosophila_2:1627813_at:392:393; Interrogation_Position=1615; Antisense; GAAATGAAGCGCATGGTTACCACAG

Paste this into a BLAST search page for me
GGCAAACAACGTCTGCTAACACTTTTAACACTTTTTAGACTTCCCCTCAGGACTTCCCCTCAGTAATAGTCTGGAAATATAACCAGATCGGCTACCACCGACCGATCCCAAAGCGGAGCATTTTATGCGGTTTGCCGAGTATCACATTGATGAACGGGCCTATCTACTGCACGAAGAATTGGCCCAAGAGCATCTGAATTTATGGAGCTTTCTGAGTCTCATGGTGGTTATATGCAAGGCCCACGCGATTCCACGCGATTCTCGGCAAGATCGAAGAGATTCTGGCCGAAGCCTTCGAGCGAACCTTGACCTGTGCTTATTCATAGAAATGAAGCGCATGGTTACCACAG

Full Affymetrix probeset data:

Annotations for 1627813_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime