FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627814_at:

>probe:Drosophila_2:1627814_at:473:507; Interrogation_Position=109; Antisense; GTGAATAGGAAATTTCCCCAGTTCG
>probe:Drosophila_2:1627814_at:560:631; Interrogation_Position=123; Antisense; TCCCCAGTTCGGAAATTCCATCGAT
>probe:Drosophila_2:1627814_at:671:617; Interrogation_Position=13; Antisense; TGCATCACAGCTCATCTCGTGGATG
>probe:Drosophila_2:1627814_at:291:307; Interrogation_Position=140; Antisense; CCATCGATGATGAACGAGAGGCCGA
>probe:Drosophila_2:1627814_at:393:313; Interrogation_Position=195; Antisense; GCCACCCGTTTTTGACTTCGGAATG
>probe:Drosophila_2:1627814_at:10:209; Interrogation_Position=216; Antisense; AATGCCCAGGAATATTACAACCCGG
>probe:Drosophila_2:1627814_at:634:287; Interrogation_Position=238; Antisense; CGGACGGGACACACGGCGGCCATCA
>probe:Drosophila_2:1627814_at:190:289; Interrogation_Position=254; Antisense; CGGCCATCAATTGCCGCGTTGACAA
>probe:Drosophila_2:1627814_at:129:627; Interrogation_Position=265; Antisense; TGCCGCGTTGACAATCTGGGTGATA
>probe:Drosophila_2:1627814_at:547:639; Interrogation_Position=27; Antisense; TCTCGTGGATGGCAATGACAACCTG
>probe:Drosophila_2:1627814_at:456:237; Interrogation_Position=290; Antisense; AATCGGTGAGTGAATCAGCCGGCAA
>probe:Drosophila_2:1627814_at:685:231; Interrogation_Position=40; Antisense; AATGACAACCTGTTGCCCATGGTTT
>probe:Drosophila_2:1627814_at:501:539; Interrogation_Position=60; Antisense; GGTTTCTGCACCATCGAGCATTGAT
>probe:Drosophila_2:1627814_at:26:15; Interrogation_Position=89; Antisense; ATTACGTTTACATTGCTTCGGTGAA

Paste this into a BLAST search page for me
GTGAATAGGAAATTTCCCCAGTTCGTCCCCAGTTCGGAAATTCCATCGATTGCATCACAGCTCATCTCGTGGATGCCATCGATGATGAACGAGAGGCCGAGCCACCCGTTTTTGACTTCGGAATGAATGCCCAGGAATATTACAACCCGGCGGACGGGACACACGGCGGCCATCACGGCCATCAATTGCCGCGTTGACAATGCCGCGTTGACAATCTGGGTGATATCTCGTGGATGGCAATGACAACCTGAATCGGTGAGTGAATCAGCCGGCAAAATGACAACCTGTTGCCCATGGTTTGGTTTCTGCACCATCGAGCATTGATATTACGTTTACATTGCTTCGGTGAA

Full Affymetrix probeset data:

Annotations for 1627814_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720