FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627815_at:

>probe:Drosophila_2:1627815_at:280:203; Interrogation_Position=248; Antisense; AAGCCCGCACTGAGGTCTTCAAGTG
>probe:Drosophila_2:1627815_at:409:33; Interrogation_Position=277; Antisense; ATCAACGATGTGACCGACTGGCTGC
>probe:Drosophila_2:1627815_at:240:407; Interrogation_Position=292; Antisense; GACTGGCTGCGCAACTTTGGTTATC
>probe:Drosophila_2:1627815_at:19:539; Interrogation_Position=310; Antisense; GGTTATCCCGAGTACGAGCAAACTT
>probe:Drosophila_2:1627815_at:357:621; Interrogation_Position=365; Antisense; TGCTGAATCTGGACGCAGTTGCTCT
>probe:Drosophila_2:1627815_at:251:95; Interrogation_Position=381; Antisense; AGTTGCTCTGGTTGCGCTCAACGTT
>probe:Drosophila_2:1627815_at:654:651; Interrogation_Position=398; Antisense; TCAACGTTCGCAACTTCGAGCACAT
>probe:Drosophila_2:1627815_at:299:595; Interrogation_Position=431; Antisense; TGGGCCGCGGCATACGAGCGCTTTA
>probe:Drosophila_2:1627815_at:672:77; Interrogation_Position=500; Antisense; AGGTCTATAAGACATTCCGGGCCCG
>probe:Drosophila_2:1627815_at:96:349; Interrogation_Position=572; Antisense; GCATGCACATGATTCGCTCCGTTTT
>probe:Drosophila_2:1627815_at:568:325; Interrogation_Position=599; Antisense; GCGACGTCAACGACTGGGATCTGAT
>probe:Drosophila_2:1627815_at:342:529; Interrogation_Position=614; Antisense; GGGATCTGATGGAGCTGCACATGTC
>probe:Drosophila_2:1627815_at:194:527; Interrogation_Position=719; Antisense; GGGAACCCATCATTACGGACGATGT
>probe:Drosophila_2:1627815_at:588:251; Interrogation_Position=750; Antisense; CACACCGTGGTACAACTTCGAGGAT

Paste this into a BLAST search page for me
AAGCCCGCACTGAGGTCTTCAAGTGATCAACGATGTGACCGACTGGCTGCGACTGGCTGCGCAACTTTGGTTATCGGTTATCCCGAGTACGAGCAAACTTTGCTGAATCTGGACGCAGTTGCTCTAGTTGCTCTGGTTGCGCTCAACGTTTCAACGTTCGCAACTTCGAGCACATTGGGCCGCGGCATACGAGCGCTTTAAGGTCTATAAGACATTCCGGGCCCGGCATGCACATGATTCGCTCCGTTTTGCGACGTCAACGACTGGGATCTGATGGGATCTGATGGAGCTGCACATGTCGGGAACCCATCATTACGGACGATGTCACACCGTGGTACAACTTCGAGGAT

Full Affymetrix probeset data:

Annotations for 1627815_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720