FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627817_at:

>probe:Drosophila_2:1627817_at:247:615; Interrogation_Position=317; Antisense; TGCAAGCTCTAACTGGTCTAGGTTT
>probe:Drosophila_2:1627817_at:674:495; Interrogation_Position=332; Antisense; GTCTAGGTTTGAGCATATCTCCATT
>probe:Drosophila_2:1627817_at:477:435; Interrogation_Position=388; Antisense; GAGGAGCAACTTGTCTCGAAACTTA
>probe:Drosophila_2:1627817_at:43:371; Interrogation_Position=424; Antisense; GAATGGAAGTTCTGGGCTGCCGCAA
>probe:Drosophila_2:1627817_at:660:335; Interrogation_Position=439; Antisense; GCTGCCGCAAAGGTGTCGAAAGTTC
>probe:Drosophila_2:1627817_at:72:289; Interrogation_Position=491; Antisense; CGGAGGCTGTTTCCATCACTGAAAA
>probe:Drosophila_2:1627817_at:289:711; Interrogation_Position=517; Antisense; TTCAACAGTCGTTACGGCCTTCGAT
>probe:Drosophila_2:1627817_at:452:287; Interrogation_Position=531; Antisense; CGGCCTTCGATTGCGTAGTTGTGTT
>probe:Drosophila_2:1627817_at:19:515; Interrogation_Position=551; Antisense; GTGTTGGTCTGTTTATCTGGAATCA
>probe:Drosophila_2:1627817_at:640:559; Interrogation_Position=597; Antisense; GGAAAGTTCCCTAAATGGCCTGCAA
>probe:Drosophila_2:1627817_at:320:197; Interrogation_Position=627; Antisense; AACGGAGCACTTGATCGATGTCACT
>probe:Drosophila_2:1627817_at:333:443; Interrogation_Position=643; Antisense; GATGTCACTGAAGGCTGTTCCAGCG
>probe:Drosophila_2:1627817_at:309:441; Interrogation_Position=709; Antisense; GATGGCATCCAGAATGCTCCACAGA
>probe:Drosophila_2:1627817_at:182:365; Interrogation_Position=732; Antisense; GAATTTGCTGAATCTGCGGACTAAG

Paste this into a BLAST search page for me
TGCAAGCTCTAACTGGTCTAGGTTTGTCTAGGTTTGAGCATATCTCCATTGAGGAGCAACTTGTCTCGAAACTTAGAATGGAAGTTCTGGGCTGCCGCAAGCTGCCGCAAAGGTGTCGAAAGTTCCGGAGGCTGTTTCCATCACTGAAAATTCAACAGTCGTTACGGCCTTCGATCGGCCTTCGATTGCGTAGTTGTGTTGTGTTGGTCTGTTTATCTGGAATCAGGAAAGTTCCCTAAATGGCCTGCAAAACGGAGCACTTGATCGATGTCACTGATGTCACTGAAGGCTGTTCCAGCGGATGGCATCCAGAATGCTCCACAGAGAATTTGCTGAATCTGCGGACTAAG

Full Affymetrix probeset data:

Annotations for 1627817_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720