FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627819_at:

>probe:Drosophila_2:1627819_at:262:189; Interrogation_Position=1001; Antisense; AACAGTCTACCTTAACAGCGCAAAT
>probe:Drosophila_2:1627819_at:14:541; Interrogation_Position=1112; Antisense; GGTTTATGATCCTCTGCAGTCAACA
>probe:Drosophila_2:1627819_at:194:75; Interrogation_Position=1144; Antisense; AGGATTACGGCTTTCAAGTTCTCAA
>probe:Drosophila_2:1627819_at:180:217; Interrogation_Position=1159; Antisense; AAGTTCTCAACGTTGTCCTTGCAGA
>probe:Drosophila_2:1627819_at:588:629; Interrogation_Position=1174; Antisense; TCCTTGCAGAGTTTTACGGCCATTC
>probe:Drosophila_2:1627819_at:535:141; Interrogation_Position=1189; Antisense; ACGGCCATTCTAAGTACCTCGATAA
>probe:Drosophila_2:1627819_at:196:3; Interrogation_Position=1227; Antisense; ATTGCGGTCAGTTTACTTCGACGAC
>probe:Drosophila_2:1627819_at:667:579; Interrogation_Position=673; Antisense; GGCCAATTTCATTTGCTACACCAAC
>probe:Drosophila_2:1627819_at:589:477; Interrogation_Position=707; Antisense; GTTTATTTGCGGGTTCCAATGCGGA
>probe:Drosophila_2:1627819_at:466:685; Interrogation_Position=792; Antisense; TATCAGTTTTGCTAAGCGCCTCGAG
>probe:Drosophila_2:1627819_at:489:555; Interrogation_Position=816; Antisense; GGACTTTTTCAACCCAATTCTACTG
>probe:Drosophila_2:1627819_at:357:59; Interrogation_Position=850; Antisense; ATGATTTCCTCCGTACTTATTTGCA
>probe:Drosophila_2:1627819_at:98:33; Interrogation_Position=934; Antisense; ATAATTTACATATCCTCGGCCCTTT
>probe:Drosophila_2:1627819_at:558:295; Interrogation_Position=949; Antisense; TCGGCCCTTTCACAATTATACGTTC

Paste this into a BLAST search page for me
AACAGTCTACCTTAACAGCGCAAATGGTTTATGATCCTCTGCAGTCAACAAGGATTACGGCTTTCAAGTTCTCAAAAGTTCTCAACGTTGTCCTTGCAGATCCTTGCAGAGTTTTACGGCCATTCACGGCCATTCTAAGTACCTCGATAAATTGCGGTCAGTTTACTTCGACGACGGCCAATTTCATTTGCTACACCAACGTTTATTTGCGGGTTCCAATGCGGATATCAGTTTTGCTAAGCGCCTCGAGGGACTTTTTCAACCCAATTCTACTGATGATTTCCTCCGTACTTATTTGCAATAATTTACATATCCTCGGCCCTTTTCGGCCCTTTCACAATTATACGTTC

Full Affymetrix probeset data:

Annotations for 1627819_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720