FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627820_at:

>probe:Drosophila_2:1627820_at:219:671; Interrogation_Position=144; Antisense; TACGAATTCCAGAATGTCGGATTTG
>probe:Drosophila_2:1627820_at:573:595; Interrogation_Position=177; Antisense; TGTGGCGAGCGAAGAAGGCTCCAAT
>probe:Drosophila_2:1627820_at:422:527; Interrogation_Position=209; Antisense; GGGAAACCATTTGGTACACCATTGG
>probe:Drosophila_2:1627820_at:112:157; Interrogation_Position=224; Antisense; ACACCATTGGAGAGCTTGTGGAAAT
>probe:Drosophila_2:1627820_at:161:595; Interrogation_Position=265; Antisense; TGTGGAATATCCATGGTATCGTTCA
>probe:Drosophila_2:1627820_at:499:481; Interrogation_Position=280; Antisense; GTATCGTTCAAAAATCGCTTCGCCC
>probe:Drosophila_2:1627820_at:488:343; Interrogation_Position=296; Antisense; GCTTCGCCCACATCAAGAAGTGCTT
>probe:Drosophila_2:1627820_at:256:221; Interrogation_Position=313; Antisense; AAGTGCTTCAGCATCAAGAGACGAG
>probe:Drosophila_2:1627820_at:38:425; Interrogation_Position=330; Antisense; GAGACGAGGTCCTTTGTACAGGATT
>probe:Drosophila_2:1627820_at:605:681; Interrogation_Position=361; Antisense; TATGCGGAGTGCAAGTGCGGCTTTC
>probe:Drosophila_2:1627820_at:640:331; Interrogation_Position=377; Antisense; GCGGCTTTCTTATTGCAGACACGGA
>probe:Drosophila_2:1627820_at:354:203; Interrogation_Position=404; Antisense; AAGCCCGGAAACTGCATTGTTGTTC
>probe:Drosophila_2:1627820_at:652:231; Interrogation_Position=53; Antisense; AATGACCTGCTAATGCAGTGGGATT
>probe:Drosophila_2:1627820_at:20:519; Interrogation_Position=70; Antisense; GTGGGATTGAGTTATTCCATCATAA

Paste this into a BLAST search page for me
TACGAATTCCAGAATGTCGGATTTGTGTGGCGAGCGAAGAAGGCTCCAATGGGAAACCATTTGGTACACCATTGGACACCATTGGAGAGCTTGTGGAAATTGTGGAATATCCATGGTATCGTTCAGTATCGTTCAAAAATCGCTTCGCCCGCTTCGCCCACATCAAGAAGTGCTTAAGTGCTTCAGCATCAAGAGACGAGGAGACGAGGTCCTTTGTACAGGATTTATGCGGAGTGCAAGTGCGGCTTTCGCGGCTTTCTTATTGCAGACACGGAAAGCCCGGAAACTGCATTGTTGTTCAATGACCTGCTAATGCAGTGGGATTGTGGGATTGAGTTATTCCATCATAA

Full Affymetrix probeset data:

Annotations for 1627820_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720