Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627822_at:

>probe:Drosophila_2:1627822_at:22:143; Interrogation_Position=2776; Antisense; ACTGGCGTCTGGTCATGCGAAATTT
>probe:Drosophila_2:1627822_at:316:49; Interrogation_Position=2790; Antisense; ATGCGAAATTTCGTCATCTTCCTCA
>probe:Drosophila_2:1627822_at:399:321; Interrogation_Position=2832; Antisense; GCCCGATCGGATGGCATGTTCTGAT
>probe:Drosophila_2:1627822_at:656:59; Interrogation_Position=2847; Antisense; ATGTTCTGATCCTGAGCGATTCGCA
>probe:Drosophila_2:1627822_at:538:417; Interrogation_Position=2860; Antisense; GAGCGATTCGCAATCCAATTGCCGC
>probe:Drosophila_2:1627822_at:114:717; Interrogation_Position=2878; Antisense; TTGCCGCCCAGGTATTGACCCAAAG
>probe:Drosophila_2:1627822_at:646:455; Interrogation_Position=2912; Antisense; GATAGCATAGCCTATTCGGCAAATA
>probe:Drosophila_2:1627822_at:559:561; Interrogation_Position=2968; Antisense; GGAACGGTTCTGTATTTAAGCTTAT
>probe:Drosophila_2:1627822_at:26:167; Interrogation_Position=3000; Antisense; AAATCCATTTGCCATATCTCGATAT
>probe:Drosophila_2:1627822_at:598:147; Interrogation_Position=3038; Antisense; ACTTAACTCTAAGGCCATGGGTCAA
>probe:Drosophila_2:1627822_at:413:693; Interrogation_Position=3077; Antisense; TTTGCCTAAGAAACCCCGGGATCTG
>probe:Drosophila_2:1627822_at:394:19; Interrogation_Position=3184; Antisense; ATTTGCGCCGATGTATACAGCCTAG
>probe:Drosophila_2:1627822_at:97:665; Interrogation_Position=3199; Antisense; TACAGCCTAGGGTTAACTTAGCCTT
>probe:Drosophila_2:1627822_at:470:187; Interrogation_Position=3265; Antisense; AACACACTCACACTCAAACATAAGC

Paste this into a BLAST search page for me
ACTGGCGTCTGGTCATGCGAAATTTATGCGAAATTTCGTCATCTTCCTCAGCCCGATCGGATGGCATGTTCTGATATGTTCTGATCCTGAGCGATTCGCAGAGCGATTCGCAATCCAATTGCCGCTTGCCGCCCAGGTATTGACCCAAAGGATAGCATAGCCTATTCGGCAAATAGGAACGGTTCTGTATTTAAGCTTATAAATCCATTTGCCATATCTCGATATACTTAACTCTAAGGCCATGGGTCAATTTGCCTAAGAAACCCCGGGATCTGATTTGCGCCGATGTATACAGCCTAGTACAGCCTAGGGTTAACTTAGCCTTAACACACTCACACTCAAACATAAGC

Full Affymetrix probeset data:

Annotations for 1627822_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime