FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627823_at:

>probe:Drosophila_2:1627823_at:403:197; Interrogation_Position=168; Antisense; AACGTGCCACTTTGATGACTCTATC
>probe:Drosophila_2:1627823_at:205:509; Interrogation_Position=263; Antisense; GTGCTAGCAGCCACAGGAACACCAT
>probe:Drosophila_2:1627823_at:76:561; Interrogation_Position=278; Antisense; GGAACACCATCAAACACACGCAACG
>probe:Drosophila_2:1627823_at:15:137; Interrogation_Position=295; Antisense; ACGCAACGTGACCAAATTCTCGCTG
>probe:Drosophila_2:1627823_at:241:389; Interrogation_Position=355; Antisense; GAAACGTTTTAAGCGCCTGGACTGG
>probe:Drosophila_2:1627823_at:580:7; Interrogation_Position=399; Antisense; ATTCCGGTCGCCAAAAGAAGCTCTT
>probe:Drosophila_2:1627823_at:714:209; Interrogation_Position=425; Antisense; AAGAAATCCGCAGCTTTACGACGCC
>probe:Drosophila_2:1627823_at:167:653; Interrogation_Position=453; Antisense; TCAAGCAGCACGTCTTCACCAATGC
>probe:Drosophila_2:1627823_at:470:99; Interrogation_Position=501; Antisense; AGATGGTCACCAGCTATTGGCGGCG
>probe:Drosophila_2:1627823_at:304:3; Interrogation_Position=516; Antisense; ATTGGCGGCGCCCAAAGCATTTCAT
>probe:Drosophila_2:1627823_at:157:117; Interrogation_Position=531; Antisense; AGCATTTCATCAACGATCCCTATAA
>probe:Drosophila_2:1627823_at:26:687; Interrogation_Position=551; Antisense; TATAAGCCCTATCACAGCCGCAACG
>probe:Drosophila_2:1627823_at:528:489; Interrogation_Position=577; Antisense; GTACTACGCCACACAGTCAAAGACC
>probe:Drosophila_2:1627823_at:497:223; Interrogation_Position=605; Antisense; AAGGTGTGACCTGGCTAATCAAAGA

Paste this into a BLAST search page for me
AACGTGCCACTTTGATGACTCTATCGTGCTAGCAGCCACAGGAACACCATGGAACACCATCAAACACACGCAACGACGCAACGTGACCAAATTCTCGCTGGAAACGTTTTAAGCGCCTGGACTGGATTCCGGTCGCCAAAAGAAGCTCTTAAGAAATCCGCAGCTTTACGACGCCTCAAGCAGCACGTCTTCACCAATGCAGATGGTCACCAGCTATTGGCGGCGATTGGCGGCGCCCAAAGCATTTCATAGCATTTCATCAACGATCCCTATAATATAAGCCCTATCACAGCCGCAACGGTACTACGCCACACAGTCAAAGACCAAGGTGTGACCTGGCTAATCAAAGA

Full Affymetrix probeset data:

Annotations for 1627823_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720