FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627824_at:

>probe:Drosophila_2:1627824_at:597:611; Interrogation_Position=101; Antisense; TGAAAGTTCCATTTTTCTCCAGCTC
>probe:Drosophila_2:1627824_at:414:95; Interrogation_Position=153; Antisense; AGATAGCGACTCATGTTTTCCAAAA
>probe:Drosophila_2:1627824_at:134:701; Interrogation_Position=168; Antisense; TTTTCCAAAATTGTCTCGCCTGCAG
>probe:Drosophila_2:1627824_at:577:229; Interrogation_Position=222; Antisense; AATGGGCGCATTGTGCATGACCCTT
>probe:Drosophila_2:1627824_at:17:471; Interrogation_Position=252; Antisense; GTTCTACATTCCCTTCCTAATATTG
>probe:Drosophila_2:1627824_at:592:313; Interrogation_Position=280; Antisense; GCCAGAAAGTTTGCCTTGCTCTACA
>probe:Drosophila_2:1627824_at:477:555; Interrogation_Position=30; Antisense; GGACCTGGATGAATACTTGCTACTG
>probe:Drosophila_2:1627824_at:28:585; Interrogation_Position=309; Antisense; TGGCAGCCTCTTTTTCATTTTGAGC
>probe:Drosophila_2:1627824_at:485:601; Interrogation_Position=374; Antisense; TGTTTTCCAAACCAAGACTGCTCAC
>probe:Drosophila_2:1627824_at:283:131; Interrogation_Position=397; Antisense; ACCTCGCTTTCATATAGTTCCTGTT
>probe:Drosophila_2:1627824_at:670:455; Interrogation_Position=423; Antisense; GATTTTAACCTTATACTGCGCCTTG
>probe:Drosophila_2:1627824_at:131:521; Interrogation_Position=448; Antisense; GTGGCCAAAAGCACCGCATTTACAG
>probe:Drosophila_2:1627824_at:18:709; Interrogation_Position=467; Antisense; TTACAGTCCTTTTTGCAGTGGCGCA
>probe:Drosophila_2:1627824_at:235:7; Interrogation_Position=496; Antisense; ATTGCATTGCTCTTTATGGTCCTGG

Paste this into a BLAST search page for me
TGAAAGTTCCATTTTTCTCCAGCTCAGATAGCGACTCATGTTTTCCAAAATTTTCCAAAATTGTCTCGCCTGCAGAATGGGCGCATTGTGCATGACCCTTGTTCTACATTCCCTTCCTAATATTGGCCAGAAAGTTTGCCTTGCTCTACAGGACCTGGATGAATACTTGCTACTGTGGCAGCCTCTTTTTCATTTTGAGCTGTTTTCCAAACCAAGACTGCTCACACCTCGCTTTCATATAGTTCCTGTTGATTTTAACCTTATACTGCGCCTTGGTGGCCAAAAGCACCGCATTTACAGTTACAGTCCTTTTTGCAGTGGCGCAATTGCATTGCTCTTTATGGTCCTGG

Full Affymetrix probeset data:

Annotations for 1627824_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720