FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627825_at:

>probe:Drosophila_2:1627825_at:390:495; Interrogation_Position=1003; Antisense; GTCACGGCGAACATCGTTGGGACAT
>probe:Drosophila_2:1627825_at:520:427; Interrogation_Position=1045; Antisense; GAGATCAGACCTCGATTTGCATACT
>probe:Drosophila_2:1627825_at:505:345; Interrogation_Position=1063; Antisense; GCATACTCCATAACATTTTTCCCAT
>probe:Drosophila_2:1627825_at:170:601; Interrogation_Position=1105; Antisense; TGTACATACCCATGCGAACTCGCAT
>probe:Drosophila_2:1627825_at:143:193; Interrogation_Position=556; Antisense; AACTATCGGCCGAGTTATCAGCCCT
>probe:Drosophila_2:1627825_at:306:123; Interrogation_Position=575; Antisense; AGCCCTTGGGCTTGGATTACCAGCA
>probe:Drosophila_2:1627825_at:83:353; Interrogation_Position=645; Antisense; GCAGCAGAGTGTCCAGTACCAGCAG
>probe:Drosophila_2:1627825_at:166:629; Interrogation_Position=681; Antisense; TCCACACGCCGATTTGGCCAAATAT
>probe:Drosophila_2:1627825_at:647:411; Interrogation_Position=766; Antisense; GACCCAGGAGGTACGCCAAGGATCT
>probe:Drosophila_2:1627825_at:174:373; Interrogation_Position=814; Antisense; GAAGTCCAGCTGACCGAAGTGCCAA
>probe:Drosophila_2:1627825_at:364:17; Interrogation_Position=861; Antisense; ATTTTCATGCGCTTTGATGCACCCG
>probe:Drosophila_2:1627825_at:566:445; Interrogation_Position=876; Antisense; GATGCACCCGATTCGCGGAGTCATG
>probe:Drosophila_2:1627825_at:17:431; Interrogation_Position=893; Antisense; GAGTCATGGCCACGTCCTGAAGCAT
>probe:Drosophila_2:1627825_at:471:19; Interrogation_Position=938; Antisense; ATTTGAATCCCAGCGAGGCACGAAT

Paste this into a BLAST search page for me
GTCACGGCGAACATCGTTGGGACATGAGATCAGACCTCGATTTGCATACTGCATACTCCATAACATTTTTCCCATTGTACATACCCATGCGAACTCGCATAACTATCGGCCGAGTTATCAGCCCTAGCCCTTGGGCTTGGATTACCAGCAGCAGCAGAGTGTCCAGTACCAGCAGTCCACACGCCGATTTGGCCAAATATGACCCAGGAGGTACGCCAAGGATCTGAAGTCCAGCTGACCGAAGTGCCAAATTTTCATGCGCTTTGATGCACCCGGATGCACCCGATTCGCGGAGTCATGGAGTCATGGCCACGTCCTGAAGCATATTTGAATCCCAGCGAGGCACGAAT

Full Affymetrix probeset data:

Annotations for 1627825_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720