Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627826_s_at:

>probe:Drosophila_2:1627826_s_at:26:299; Interrogation_Position=343; Antisense; CGCAGCCTGTGAGCACTGGTCAAAC
>probe:Drosophila_2:1627826_s_at:304:95; Interrogation_Position=426; Antisense; AGATACCATGAAGCCCATGTGCCCA
>probe:Drosophila_2:1627826_s_at:668:233; Interrogation_Position=469; Antisense; AATGCCAGCTCTGCGACAAGGTATT
>probe:Drosophila_2:1627826_s_at:166:309; Interrogation_Position=500; Antisense; CCAGGATCATCTCAAGGTACACGTG
>probe:Drosophila_2:1627826_s_at:379:615; Interrogation_Position=523; Antisense; TGAAGATTGAGCACGCGACCGATGG
>probe:Drosophila_2:1627826_s_at:209:413; Interrogation_Position=539; Antisense; GACCGATGGCTACCAACCAGATGAG
>probe:Drosophila_2:1627826_s_at:539:373; Interrogation_Position=563; Antisense; GAAGTCCTTAGATTGGCAGCACTAC
>probe:Drosophila_2:1627826_s_at:443:685; Interrogation_Position=618; Antisense; TATAAGCTGGATCCCATCTTGTGTC
>probe:Drosophila_2:1627826_s_at:616:171; Interrogation_Position=650; Antisense; AAAGAGGAAGTATCCGCCGCGCTCC
>probe:Drosophila_2:1627826_s_at:185:707; Interrogation_Position=681; Antisense; TTCAATCCGAATCTCTGGCTAGGCG
>probe:Drosophila_2:1627826_s_at:492:571; Interrogation_Position=697; Antisense; GGCTAGGCGCTGACAACTGTTTTAT
>probe:Drosophila_2:1627826_s_at:533:61; Interrogation_Position=745; Antisense; ATGTCTTGCGAAGGGCTGACCGATT
>probe:Drosophila_2:1627826_s_at:481:293; Interrogation_Position=765; Antisense; CGATTTATTGAGTCTTATGCGCCAT
>probe:Drosophila_2:1627826_s_at:313:625; Interrogation_Position=782; Antisense; TGCGCCATCATCTATCCATTGTAAA

Paste this into a BLAST search page for me
CGCAGCCTGTGAGCACTGGTCAAACAGATACCATGAAGCCCATGTGCCCAAATGCCAGCTCTGCGACAAGGTATTCCAGGATCATCTCAAGGTACACGTGTGAAGATTGAGCACGCGACCGATGGGACCGATGGCTACCAACCAGATGAGGAAGTCCTTAGATTGGCAGCACTACTATAAGCTGGATCCCATCTTGTGTCAAAGAGGAAGTATCCGCCGCGCTCCTTCAATCCGAATCTCTGGCTAGGCGGGCTAGGCGCTGACAACTGTTTTATATGTCTTGCGAAGGGCTGACCGATTCGATTTATTGAGTCTTATGCGCCATTGCGCCATCATCTATCCATTGTAAA

Full Affymetrix probeset data:

Annotations for 1627826_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime