Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627827_a_at:

>probe:Drosophila_2:1627827_a_at:260:219; Interrogation_Position=458; Antisense; AAGTCGAGCAATGCCAAGGTCCTGC
>probe:Drosophila_2:1627827_a_at:317:449; Interrogation_Position=541; Antisense; GATCCTCATAATTAAGCTGCGCAAG
>probe:Drosophila_2:1627827_a_at:318:221; Interrogation_Position=623; Antisense; AAGTGGAATCCTACCGCAGGCGTGT
>probe:Drosophila_2:1627827_a_at:325:349; Interrogation_Position=638; Antisense; GCAGGCGTGTGCTTCGAGTATGATC
>probe:Drosophila_2:1627827_a_at:454:483; Interrogation_Position=655; Antisense; GTATGATCCGGACAACTCCATGCGA
>probe:Drosophila_2:1627827_a_at:432:259; Interrogation_Position=682; Antisense; CACTCTGTATCCCAAACCTGATGAG
>probe:Drosophila_2:1627827_a_at:541:213; Interrogation_Position=713; Antisense; AAGAGCGAGCACACCGAACTGGAGG
>probe:Drosophila_2:1627827_a_at:696:487; Interrogation_Position=745; Antisense; GTACGAGGCGCCCTACAACTGGGAA
>probe:Drosophila_2:1627827_a_at:176:217; Interrogation_Position=782; Antisense; AAGTTCTTCTTCAACGTCGAATCCG
>probe:Drosophila_2:1627827_a_at:61:289; Interrogation_Position=808; Antisense; CGGTGCCCTTAAGCCTGAGAACATT
>probe:Drosophila_2:1627827_a_at:344:207; Interrogation_Position=863; Antisense; AAGCTGTCAAACCTGCAGACGCAAC
>probe:Drosophila_2:1627827_a_at:154:313; Interrogation_Position=891; Antisense; GCCACGAGTCCCAAAACGATGCATT
>probe:Drosophila_2:1627827_a_at:637:445; Interrogation_Position=908; Antisense; GATGCATTGGCCGTTTGATTTACAT
>probe:Drosophila_2:1627827_a_at:190:21; Interrogation_Position=955; Antisense; ATAAAAGATGTTCCGCCTAATCCTT

Paste this into a BLAST search page for me
AAGTCGAGCAATGCCAAGGTCCTGCGATCCTCATAATTAAGCTGCGCAAGAAGTGGAATCCTACCGCAGGCGTGTGCAGGCGTGTGCTTCGAGTATGATCGTATGATCCGGACAACTCCATGCGACACTCTGTATCCCAAACCTGATGAGAAGAGCGAGCACACCGAACTGGAGGGTACGAGGCGCCCTACAACTGGGAAAAGTTCTTCTTCAACGTCGAATCCGCGGTGCCCTTAAGCCTGAGAACATTAAGCTGTCAAACCTGCAGACGCAACGCCACGAGTCCCAAAACGATGCATTGATGCATTGGCCGTTTGATTTACATATAAAAGATGTTCCGCCTAATCCTT

Full Affymetrix probeset data:

Annotations for 1627827_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime