FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627829_at:

>probe:Drosophila_2:1627829_at:454:315; Interrogation_Position=1006; Antisense; GCCTGTGCCTGCAAAATGGTGGCCT
>probe:Drosophila_2:1627829_at:69:43; Interrogation_Position=1033; Antisense; ATCGATCCGTTCGTGTACGCCATAA
>probe:Drosophila_2:1627829_at:199:601; Interrogation_Position=1046; Antisense; TGTACGCCATAAGTCATCCCAGATA
>probe:Drosophila_2:1627829_at:570:303; Interrogation_Position=1097; Antisense; CCTGGCTGGCGCTCAACGAAAAGGC
>probe:Drosophila_2:1627829_at:348:183; Interrogation_Position=1115; Antisense; AAAAGGCGCCGGAATCGTCGGCTGT
>probe:Drosophila_2:1627829_at:88:385; Interrogation_Position=1257; Antisense; GAACTCGTAATACCAAACGCCAGGG
>probe:Drosophila_2:1627829_at:359:21; Interrogation_Position=1294; Antisense; ATATTTCACGGAGTTTCTGCTAGAG
>probe:Drosophila_2:1627829_at:533:367; Interrogation_Position=829; Antisense; GAATCGCTGCGTTCGAATGTGGACA
>probe:Drosophila_2:1627829_at:241:47; Interrogation_Position=874; Antisense; ATCCGGATAGCCAAAGCGGCCATCA
>probe:Drosophila_2:1627829_at:352:649; Interrogation_Position=896; Antisense; TCACCATATGCTTCCTGTTCTTTTG
>probe:Drosophila_2:1627829_at:178:603; Interrogation_Position=911; Antisense; TGTTCTTTTGCTCGTGGACGCCGTA
>probe:Drosophila_2:1627829_at:573:133; Interrogation_Position=928; Antisense; ACGCCGTACGGAGTTATGTCGCTGA
>probe:Drosophila_2:1627829_at:705:453; Interrogation_Position=967; Antisense; GATAAGACCCTTTTGACGCCCGGAG
>probe:Drosophila_2:1627829_at:626:553; Interrogation_Position=988; Antisense; GGAGCCACAATGATTCCCGCCTGTG

Paste this into a BLAST search page for me
GCCTGTGCCTGCAAAATGGTGGCCTATCGATCCGTTCGTGTACGCCATAATGTACGCCATAAGTCATCCCAGATACCTGGCTGGCGCTCAACGAAAAGGCAAAAGGCGCCGGAATCGTCGGCTGTGAACTCGTAATACCAAACGCCAGGGATATTTCACGGAGTTTCTGCTAGAGGAATCGCTGCGTTCGAATGTGGACAATCCGGATAGCCAAAGCGGCCATCATCACCATATGCTTCCTGTTCTTTTGTGTTCTTTTGCTCGTGGACGCCGTAACGCCGTACGGAGTTATGTCGCTGAGATAAGACCCTTTTGACGCCCGGAGGGAGCCACAATGATTCCCGCCTGTG

Full Affymetrix probeset data:

Annotations for 1627829_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720