Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627830_at:

>probe:Drosophila_2:1627830_at:639:549; Interrogation_Position=1998; Antisense; GGAGTCAGTCTTCCCGAACATTTTC
>probe:Drosophila_2:1627830_at:589:695; Interrogation_Position=2019; Antisense; TTTCAACAGTGGCTTCGATGTCATA
>probe:Drosophila_2:1627830_at:134:463; Interrogation_Position=2080; Antisense; GATTCCAATCTGTGTCGAGTCTTCC
>probe:Drosophila_2:1627830_at:322:431; Interrogation_Position=2096; Antisense; GAGTCTTCCGCAAGGACATCCTTCA
>probe:Drosophila_2:1627830_at:343:663; Interrogation_Position=2132; Antisense; TAAACTCTTCAAATGCGACCCAATT
>probe:Drosophila_2:1627830_at:643:703; Interrogation_Position=2183; Antisense; TTATCAGGCCCATATGGACACCATC
>probe:Drosophila_2:1627830_at:528:37; Interrogation_Position=2205; Antisense; ATCTTCCACGTTTATGCTATCTTGA
>probe:Drosophila_2:1627830_at:379:609; Interrogation_Position=2227; Antisense; TGAAGGTCTATGATGCCCGTTAACT
>probe:Drosophila_2:1627830_at:430:443; Interrogation_Position=2275; Antisense; GATGATTTTCATAGCTCAACCACCT
>probe:Drosophila_2:1627830_at:634:117; Interrogation_Position=2287; Antisense; AGCTCAACCACCTTACTAATGTCTT
>probe:Drosophila_2:1627830_at:273:149; Interrogation_Position=2335; Antisense; ACATTTAGTACACACCGACAGCGGT
>probe:Drosophila_2:1627830_at:432:661; Interrogation_Position=2451; Antisense; TAACAACCTTATAGTGGCCTCACAG
>probe:Drosophila_2:1627830_at:559:581; Interrogation_Position=2465; Antisense; TGGCCTCACAGCTGCACATTAACAG
>probe:Drosophila_2:1627830_at:652:263; Interrogation_Position=2487; Antisense; CAGCAATGCTTCTTCCGAGGTGTTA

Paste this into a BLAST search page for me
GGAGTCAGTCTTCCCGAACATTTTCTTTCAACAGTGGCTTCGATGTCATAGATTCCAATCTGTGTCGAGTCTTCCGAGTCTTCCGCAAGGACATCCTTCATAAACTCTTCAAATGCGACCCAATTTTATCAGGCCCATATGGACACCATCATCTTCCACGTTTATGCTATCTTGATGAAGGTCTATGATGCCCGTTAACTGATGATTTTCATAGCTCAACCACCTAGCTCAACCACCTTACTAATGTCTTACATTTAGTACACACCGACAGCGGTTAACAACCTTATAGTGGCCTCACAGTGGCCTCACAGCTGCACATTAACAGCAGCAATGCTTCTTCCGAGGTGTTA

Full Affymetrix probeset data:

Annotations for 1627830_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime