Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627831_at:

>probe:Drosophila_2:1627831_at:600:11; Interrogation_Position=430; Antisense; ATTCGGAACTCCATGCGCAATTGTG
>probe:Drosophila_2:1627831_at:698:361; Interrogation_Position=446; Antisense; GCAATTGTGTCTTGGCACCGGATAA
>probe:Drosophila_2:1627831_at:116:557; Interrogation_Position=493; Antisense; GGACTGAGCTACTTCCAATCGGAGG
>probe:Drosophila_2:1627831_at:563:153; Interrogation_Position=542; Antisense; ACAGGAAGCGATGCACTGGACTCCA
>probe:Drosophila_2:1627831_at:626:549; Interrogation_Position=567; Antisense; GGAGTCGCACAACTGCCTCAAGGAA
>probe:Drosophila_2:1627831_at:636:355; Interrogation_Position=616; Antisense; GAGGCACCGGCTGATTGGTACGAAC
>probe:Drosophila_2:1627831_at:34:223; Interrogation_Position=655; Antisense; AAGGTGTGCCACATATTCAACGATG
>probe:Drosophila_2:1627831_at:440:137; Interrogation_Position=674; Antisense; ACGATGTTCTCGACTGTTACTATAC
>probe:Drosophila_2:1627831_at:628:473; Interrogation_Position=689; Antisense; GTTACTATACGAGGGCAGCCTTGTT
>probe:Drosophila_2:1627831_at:314:623; Interrogation_Position=715; Antisense; TGCGGACTTGAGGTTGCCAGGCAAC
>probe:Drosophila_2:1627831_at:666:191; Interrogation_Position=737; Antisense; AACTAAGGTCCTTCGCAGGCGACAG
>probe:Drosophila_2:1627831_at:681:263; Interrogation_Position=768; Antisense; CAGAGCCATGATCCACAAGTGCGAG
>probe:Drosophila_2:1627831_at:46:339; Interrogation_Position=804; Antisense; GCTACCCCGGGTTGATAATGCCATG
>probe:Drosophila_2:1627831_at:492:537; Interrogation_Position=860; Antisense; GGTCATCATGGTTAGGTGCACTTAT

Paste this into a BLAST search page for me
ATTCGGAACTCCATGCGCAATTGTGGCAATTGTGTCTTGGCACCGGATAAGGACTGAGCTACTTCCAATCGGAGGACAGGAAGCGATGCACTGGACTCCAGGAGTCGCACAACTGCCTCAAGGAAGAGGCACCGGCTGATTGGTACGAACAAGGTGTGCCACATATTCAACGATGACGATGTTCTCGACTGTTACTATACGTTACTATACGAGGGCAGCCTTGTTTGCGGACTTGAGGTTGCCAGGCAACAACTAAGGTCCTTCGCAGGCGACAGCAGAGCCATGATCCACAAGTGCGAGGCTACCCCGGGTTGATAATGCCATGGGTCATCATGGTTAGGTGCACTTAT

Full Affymetrix probeset data:

Annotations for 1627831_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime