Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627832_at:

>probe:Drosophila_2:1627832_at:486:119; Interrogation_Position=2976; Antisense; AGCTGCGGGAACAACTGCTCAAGTT
>probe:Drosophila_2:1627832_at:180:519; Interrogation_Position=3035; Antisense; GTGGTGACATCAGAGCTGACCTTCT
>probe:Drosophila_2:1627832_at:296:327; Interrogation_Position=3049; Antisense; GCTGACCTTCTACATGGAGACGCTG
>probe:Drosophila_2:1627832_at:448:11; Interrogation_Position=3116; Antisense; ATTCTGGAGGAGATCTGGCTCTACT
>probe:Drosophila_2:1627832_at:137:571; Interrogation_Position=3132; Antisense; GGCTCTACTGAGCATTCCGAAGTAT
>probe:Drosophila_2:1627832_at:601:217; Interrogation_Position=3151; Antisense; AAGTATTCCATATGGTTGCCGCGGA
>probe:Drosophila_2:1627832_at:602:125; Interrogation_Position=3192; Antisense; AGCCTAGTTCGTCTTCATTGTTTGT
>probe:Drosophila_2:1627832_at:431:241; Interrogation_Position=3237; Antisense; AATACCGATTGTCGCGTCCAGTTCA
>probe:Drosophila_2:1627832_at:340:93; Interrogation_Position=3256; Antisense; AGTTCAGTCTATCTTGTTTGCCGCT
>probe:Drosophila_2:1627832_at:113:603; Interrogation_Position=3270; Antisense; TGTTTGCCGCTGTACATTGCTTGTA
>probe:Drosophila_2:1627832_at:316:723; Interrogation_Position=3286; Antisense; TTGCTTGTACTTTTATGTTCCGCCC
>probe:Drosophila_2:1627832_at:472:681; Interrogation_Position=3299; Antisense; TATGTTCCGCCCTATAGCAAAAGGA
>probe:Drosophila_2:1627832_at:102:169; Interrogation_Position=3330; Antisense; AAATGTATCTCTTTTGTTGCGCACT
>probe:Drosophila_2:1627832_at:213:653; Interrogation_Position=3437; Antisense; TCAATGGCGGTAAACGATTCCCTTG

Paste this into a BLAST search page for me
AGCTGCGGGAACAACTGCTCAAGTTGTGGTGACATCAGAGCTGACCTTCTGCTGACCTTCTACATGGAGACGCTGATTCTGGAGGAGATCTGGCTCTACTGGCTCTACTGAGCATTCCGAAGTATAAGTATTCCATATGGTTGCCGCGGAAGCCTAGTTCGTCTTCATTGTTTGTAATACCGATTGTCGCGTCCAGTTCAAGTTCAGTCTATCTTGTTTGCCGCTTGTTTGCCGCTGTACATTGCTTGTATTGCTTGTACTTTTATGTTCCGCCCTATGTTCCGCCCTATAGCAAAAGGAAAATGTATCTCTTTTGTTGCGCACTTCAATGGCGGTAAACGATTCCCTTG

Full Affymetrix probeset data:

Annotations for 1627832_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime