FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627833_at:

>probe:Drosophila_2:1627833_at:465:375; Interrogation_Position=405; Antisense; GAAGATCCACACAAGCTGCGACCAG
>probe:Drosophila_2:1627833_at:530:717; Interrogation_Position=442; Antisense; TTCCTCACCTACGAGTGCTTGATGG
>probe:Drosophila_2:1627833_at:86:143; Interrogation_Position=526; Antisense; ACGGCGCATGTGACCAACTGGAATC
>probe:Drosophila_2:1627833_at:326:427; Interrogation_Position=556; Antisense; GAGTTTGCCCGCATCTTCAAGTGGG
>probe:Drosophila_2:1627833_at:510:51; Interrogation_Position=598; Antisense; ATGCGTCACAAGGAGATCCACCTGA
>probe:Drosophila_2:1627833_at:527:605; Interrogation_Position=620; Antisense; TGATCAATGTACCATCCACACTCAA
>probe:Drosophila_2:1627833_at:608:459; Interrogation_Position=655; Antisense; GATTTCGTGAAGAACCGCGTCAGTT
>probe:Drosophila_2:1627833_at:13:317; Interrogation_Position=695; Antisense; GCCTGATCATCTACGGCAGCGAGAA
>probe:Drosophila_2:1627833_at:618:251; Interrogation_Position=771; Antisense; CAAGGTGCCCATGCGCGAGATGATC
>probe:Drosophila_2:1627833_at:609:325; Interrogation_Position=827; Antisense; GCGACCTGATTCTCGGTCTGGACAA
>probe:Drosophila_2:1627833_at:333:559; Interrogation_Position=846; Antisense; GGACAAGAGCATACTGCGCTCCGAT
>probe:Drosophila_2:1627833_at:239:577; Interrogation_Position=884; Antisense; GGCGCAGCAGCTTCAATGCCGGAAA
>probe:Drosophila_2:1627833_at:603:555; Interrogation_Position=922; Antisense; GGACCCAACTTCGTTTCACAAATCG
>probe:Drosophila_2:1627833_at:162:83; Interrogation_Position=947; Antisense; AGTCCATCGAGGGTAGCTTTCGGAA

Paste this into a BLAST search page for me
GAAGATCCACACAAGCTGCGACCAGTTCCTCACCTACGAGTGCTTGATGGACGGCGCATGTGACCAACTGGAATCGAGTTTGCCCGCATCTTCAAGTGGGATGCGTCACAAGGAGATCCACCTGATGATCAATGTACCATCCACACTCAAGATTTCGTGAAGAACCGCGTCAGTTGCCTGATCATCTACGGCAGCGAGAACAAGGTGCCCATGCGCGAGATGATCGCGACCTGATTCTCGGTCTGGACAAGGACAAGAGCATACTGCGCTCCGATGGCGCAGCAGCTTCAATGCCGGAAAGGACCCAACTTCGTTTCACAAATCGAGTCCATCGAGGGTAGCTTTCGGAA

Full Affymetrix probeset data:

Annotations for 1627833_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720