FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627836_at:

>probe:Drosophila_2:1627836_at:214:317; Interrogation_Position=1510; Antisense; GCCTCTCTGGGCTGGATATCAATTC
>probe:Drosophila_2:1627836_at:35:687; Interrogation_Position=1575; Antisense; TATCATCAAGGTCATGGCCAGCGTC
>probe:Drosophila_2:1627836_at:579:695; Interrogation_Position=1633; Antisense; TTCATTTTCACCATGGTCGTCGATG
>probe:Drosophila_2:1627836_at:551:499; Interrogation_Position=1695; Antisense; GTCTGTGATCCTCCGAGTGGACGAA
>probe:Drosophila_2:1627836_at:535:103; Interrogation_Position=1727; Antisense; AGACCATGGTCGGTATGCTCCTGAT
>probe:Drosophila_2:1627836_at:594:699; Interrogation_Position=1780; Antisense; TTTATTCACAATGCGGCGGTGGCAC
>probe:Drosophila_2:1627836_at:79:391; Interrogation_Position=1815; Antisense; GAAACTCTGCACTGACATGGTCGTA
>probe:Drosophila_2:1627836_at:40:23; Interrogation_Position=1839; Antisense; ATATGACCAGGTCCAGATGCCCCTA
>probe:Drosophila_2:1627836_at:257:593; Interrogation_Position=1952; Antisense; TGGTGGGCAAAGCTCATGGCTACAA
>probe:Drosophila_2:1627836_at:299:67; Interrogation_Position=1967; Antisense; ATGGCTACAAGATCACCTTCAGGTC
>probe:Drosophila_2:1627836_at:379:307; Interrogation_Position=1982; Antisense; CCTTCAGGTCATTCTTTGTGGTTGG
>probe:Drosophila_2:1627836_at:706:479; Interrogation_Position=2006; Antisense; GTTTCCTAATCATGCTATTCACCGT
>probe:Drosophila_2:1627836_at:534:687; Interrogation_Position=2021; Antisense; TATTCACCGTTGTCATCTGCTCGAT
>probe:Drosophila_2:1627836_at:593:293; Interrogation_Position=2042; Antisense; CGATTTTCCTAATTATTGCCCACTC

Paste this into a BLAST search page for me
GCCTCTCTGGGCTGGATATCAATTCTATCATCAAGGTCATGGCCAGCGTCTTCATTTTCACCATGGTCGTCGATGGTCTGTGATCCTCCGAGTGGACGAAAGACCATGGTCGGTATGCTCCTGATTTTATTCACAATGCGGCGGTGGCACGAAACTCTGCACTGACATGGTCGTAATATGACCAGGTCCAGATGCCCCTATGGTGGGCAAAGCTCATGGCTACAAATGGCTACAAGATCACCTTCAGGTCCCTTCAGGTCATTCTTTGTGGTTGGGTTTCCTAATCATGCTATTCACCGTTATTCACCGTTGTCATCTGCTCGATCGATTTTCCTAATTATTGCCCACTC

Full Affymetrix probeset data:

Annotations for 1627836_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720