Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627837_at:

>probe:Drosophila_2:1627837_at:438:645; Interrogation_Position=1585; Antisense; TCATGGCCCGATTCCTTGAAGTTCG
>probe:Drosophila_2:1627837_at:51:471; Interrogation_Position=1605; Antisense; GTTCGGCACCATTGGCTATCTGATA
>probe:Drosophila_2:1627837_at:277:25; Interrogation_Position=1627; Antisense; ATAGGTCACGAGTTGACCCACGGCT
>probe:Drosophila_2:1627837_at:341:669; Interrogation_Position=1656; Antisense; TACGGAGGGCTCCAGTTTCGACAGC
>probe:Drosophila_2:1627837_at:260:291; Interrogation_Position=1735; Antisense; CGGGCGCAGTGCTATGTGGATTACT
>probe:Drosophila_2:1627837_at:49:241; Interrogation_Position=1782; Antisense; AATCAACCAGACAATTCGCGGCAAT
>probe:Drosophila_2:1627837_at:413:261; Interrogation_Position=1857; Antisense; CACCGGCTATCGAAACCACATGAAG
>probe:Drosophila_2:1627837_at:237:715; Interrogation_Position=1969; Antisense; TTCTTCGTGGGATTCGCGCAGCTGT
>probe:Drosophila_2:1627837_at:335:147; Interrogation_Position=2003; Antisense; ACTACGAGCCGGAGCACTACTGGGA
>probe:Drosophila_2:1627837_at:549:287; Interrogation_Position=2036; Antisense; CTGGCGCACATACCGTCGATAAGTA
>probe:Drosophila_2:1627837_at:494:589; Interrogation_Position=2069; Antisense; TGGGTGCCGTTTCCAACAACGACGA
>probe:Drosophila_2:1627837_at:632:159; Interrogation_Position=2084; Antisense; ACAACGACGATTTTGCTGAGGTCTA
>probe:Drosophila_2:1627837_at:664:331; Interrogation_Position=2098; Antisense; GCTGAGGTCTACAAGTGCCCACTGG
>probe:Drosophila_2:1627837_at:272:143; Interrogation_Position=2118; Antisense; ACTGGGCAGTCCAATGCATCCGAAG

Paste this into a BLAST search page for me
TCATGGCCCGATTCCTTGAAGTTCGGTTCGGCACCATTGGCTATCTGATAATAGGTCACGAGTTGACCCACGGCTTACGGAGGGCTCCAGTTTCGACAGCCGGGCGCAGTGCTATGTGGATTACTAATCAACCAGACAATTCGCGGCAATCACCGGCTATCGAAACCACATGAAGTTCTTCGTGGGATTCGCGCAGCTGTACTACGAGCCGGAGCACTACTGGGACTGGCGCACATACCGTCGATAAGTATGGGTGCCGTTTCCAACAACGACGAACAACGACGATTTTGCTGAGGTCTAGCTGAGGTCTACAAGTGCCCACTGGACTGGGCAGTCCAATGCATCCGAAG

Full Affymetrix probeset data:

Annotations for 1627837_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime