Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627838_at:

>probe:Drosophila_2:1627838_at:406:459; Interrogation_Position=1919; Antisense; GATATTTTTTATACTTGTCCCAAGG
>probe:Drosophila_2:1627838_at:113:721; Interrogation_Position=1933; Antisense; TTGTCCCAAGGCTTCTTCTTTAACA
>probe:Drosophila_2:1627838_at:268:571; Interrogation_Position=1942; Antisense; GGCTTCTTCTTTAACACGCATGCAA
>probe:Drosophila_2:1627838_at:437:661; Interrogation_Position=1953; Antisense; TAACACGCATGCAAGCGAAAGCGAA
>probe:Drosophila_2:1627838_at:285:239; Interrogation_Position=2003; Antisense; AATACATTCCTAAACAGAACCTCTT
>probe:Drosophila_2:1627838_at:262:263; Interrogation_Position=2017; Antisense; CAGAACCTCTTACAATCGGAAATAA
>probe:Drosophila_2:1627838_at:518:615; Interrogation_Position=2112; Antisense; TGCAAGGATTTAAATGGCTTTTCAT
>probe:Drosophila_2:1627838_at:294:149; Interrogation_Position=2184; Antisense; ACTTGAATTGACATTTGCTTAGGGA
>probe:Drosophila_2:1627838_at:506:441; Interrogation_Position=2207; Antisense; GATGGTATTATAGATCACGCTCTCT
>probe:Drosophila_2:1627838_at:250:261; Interrogation_Position=2222; Antisense; CACGCTCTCTAAAATGATGTATGTA
>probe:Drosophila_2:1627838_at:386:669; Interrogation_Position=2292; Antisense; TACGAGTATGTATGCTATTTTTTAG
>probe:Drosophila_2:1627838_at:239:605; Interrogation_Position=2304; Antisense; TGCTATTTTTTAGGCCAAACACTCA
>probe:Drosophila_2:1627838_at:236:459; Interrogation_Position=2343; Antisense; GATATTTTTATTTGAGCCCTTTGAT
>probe:Drosophila_2:1627838_at:320:327; Interrogation_Position=2382; Antisense; GCGTTTATTTAAGGCTAATCTCTAT

Paste this into a BLAST search page for me
GATATTTTTTATACTTGTCCCAAGGTTGTCCCAAGGCTTCTTCTTTAACAGGCTTCTTCTTTAACACGCATGCAATAACACGCATGCAAGCGAAAGCGAAAATACATTCCTAAACAGAACCTCTTCAGAACCTCTTACAATCGGAAATAATGCAAGGATTTAAATGGCTTTTCATACTTGAATTGACATTTGCTTAGGGAGATGGTATTATAGATCACGCTCTCTCACGCTCTCTAAAATGATGTATGTATACGAGTATGTATGCTATTTTTTAGTGCTATTTTTTAGGCCAAACACTCAGATATTTTTATTTGAGCCCTTTGATGCGTTTATTTAAGGCTAATCTCTAT

Full Affymetrix probeset data:

Annotations for 1627838_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime