FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627839_at:

>probe:Drosophila_2:1627839_at:586:27; Interrogation_Position=1827; Antisense; ATACCAATTCCCGATCTCTATGAGA
>probe:Drosophila_2:1627839_at:530:185; Interrogation_Position=1895; Antisense; AACACTGGGTTCAGATGCCCTGCTA
>probe:Drosophila_2:1627839_at:606:629; Interrogation_Position=1926; Antisense; TCCTTTGGTCCGGTGGTCAAGAATG
>probe:Drosophila_2:1627839_at:385:227; Interrogation_Position=1947; Antisense; AATGGCTTCGGAATCGGCTATTCGA
>probe:Drosophila_2:1627839_at:228:461; Interrogation_Position=1970; Antisense; GATTCAGAACGATTTTGCCGGCGCC
>probe:Drosophila_2:1627839_at:69:321; Interrogation_Position=1990; Antisense; GCGCCATTGTCACCACGTACAAAAA
>probe:Drosophila_2:1627839_at:465:677; Interrogation_Position=2038; Antisense; TAGACAGTCTGGAATCGGCATTTGA
>probe:Drosophila_2:1627839_at:611:163; Interrogation_Position=2065; Antisense; AAATTTGCGCTGTCATCCAGCAGAG
>probe:Drosophila_2:1627839_at:380:387; Interrogation_Position=2111; Antisense; GAAAATCGTGAGGAGTCCGACCCCG
>probe:Drosophila_2:1627839_at:32:633; Interrogation_Position=2126; Antisense; TCCGACCCCGAATCCAATGAATATG
>probe:Drosophila_2:1627839_at:433:483; Interrogation_Position=2193; Antisense; GTATCCCATGTGTCTGAATTGCAAT
>probe:Drosophila_2:1627839_at:597:11; Interrogation_Position=2255; Antisense; ATTCTACCCCATCTAAAGCATCTGT
>probe:Drosophila_2:1627839_at:635:345; Interrogation_Position=2272; Antisense; GCATCTGTGTCTTTGCTTTTATACC
>probe:Drosophila_2:1627839_at:692:701; Interrogation_Position=2290; Antisense; TTATACCCGCTGCTTTAATGGCTTT

Paste this into a BLAST search page for me
ATACCAATTCCCGATCTCTATGAGAAACACTGGGTTCAGATGCCCTGCTATCCTTTGGTCCGGTGGTCAAGAATGAATGGCTTCGGAATCGGCTATTCGAGATTCAGAACGATTTTGCCGGCGCCGCGCCATTGTCACCACGTACAAAAATAGACAGTCTGGAATCGGCATTTGAAAATTTGCGCTGTCATCCAGCAGAGGAAAATCGTGAGGAGTCCGACCCCGTCCGACCCCGAATCCAATGAATATGGTATCCCATGTGTCTGAATTGCAATATTCTACCCCATCTAAAGCATCTGTGCATCTGTGTCTTTGCTTTTATACCTTATACCCGCTGCTTTAATGGCTTT

Full Affymetrix probeset data:

Annotations for 1627839_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720