FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627841_at:

>probe:Drosophila_2:1627841_at:392:403; Interrogation_Position=1073; Antisense; GACTTCTGTGATATGCGTTTCCAAC
>probe:Drosophila_2:1627841_at:644:479; Interrogation_Position=1089; Antisense; GTTTCCAACATGCTTACGACCTAAT
>probe:Drosophila_2:1627841_at:351:59; Interrogation_Position=557; Antisense; ATGTACTACGTTAGTCCGCTGCTTA
>probe:Drosophila_2:1627841_at:553:39; Interrogation_Position=594; Antisense; ATCTGCAGGGATTTCCAGTGCCTAC
>probe:Drosophila_2:1627841_at:474:281; Interrogation_Position=628; Antisense; CTCCTGCGGACTAACACATTTTCAA
>probe:Drosophila_2:1627841_at:348:489; Interrogation_Position=666; Antisense; GTACTTTAGCTCATTACGTCGATGC
>probe:Drosophila_2:1627841_at:146:207; Interrogation_Position=743; Antisense; AAGCTGACTTTTGGATTCGCGGACT
>probe:Drosophila_2:1627841_at:424:557; Interrogation_Position=763; Antisense; GGACTTTCGCATTATCTTAACCGAT
>probe:Drosophila_2:1627841_at:56:661; Interrogation_Position=780; Antisense; TAACCGATTTCACGGCCGATAATTT
>probe:Drosophila_2:1627841_at:547:487; Interrogation_Position=832; Antisense; GTACCTCATTGATTTGGACTCCGTG
>probe:Drosophila_2:1627841_at:32:557; Interrogation_Position=865; Antisense; GGACGCTTCGTTCGCAGCAGGACAT
>probe:Drosophila_2:1627841_at:358:411; Interrogation_Position=910; Antisense; GACCGGCGAGGGATTCACATTTGAT
>probe:Drosophila_2:1627841_at:475:151; Interrogation_Position=926; Antisense; ACATTTGATGTCTCTGCATTCTGCT
>probe:Drosophila_2:1627841_at:220:127; Interrogation_Position=978; Antisense; ACCAGGCGTGCCTTTTGCTAAGGGA

Paste this into a BLAST search page for me
GACTTCTGTGATATGCGTTTCCAACGTTTCCAACATGCTTACGACCTAATATGTACTACGTTAGTCCGCTGCTTAATCTGCAGGGATTTCCAGTGCCTACCTCCTGCGGACTAACACATTTTCAAGTACTTTAGCTCATTACGTCGATGCAAGCTGACTTTTGGATTCGCGGACTGGACTTTCGCATTATCTTAACCGATTAACCGATTTCACGGCCGATAATTTGTACCTCATTGATTTGGACTCCGTGGGACGCTTCGTTCGCAGCAGGACATGACCGGCGAGGGATTCACATTTGATACATTTGATGTCTCTGCATTCTGCTACCAGGCGTGCCTTTTGCTAAGGGA

Full Affymetrix probeset data:

Annotations for 1627841_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720