FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627842_at:

>probe:Drosophila_2:1627842_at:184:101; Interrogation_Position=110; Antisense; AGAGGGTCCGACTGCTGTACAAAAC
>probe:Drosophila_2:1627842_at:680:489; Interrogation_Position=126; Antisense; GTACAAAACGATCTTGCGACTGCAC
>probe:Drosophila_2:1627842_at:659:405; Interrogation_Position=143; Antisense; GACTGCACAGAGGACTTCCAGCGGA
>probe:Drosophila_2:1627842_at:439:561; Interrogation_Position=165; Antisense; GGAACTTCGTGCTCTGGGCGATAAC
>probe:Drosophila_2:1627842_at:260:193; Interrogation_Position=187; Antisense; AACTATGTGCGGGACGAGTTCCGGC
>probe:Drosophila_2:1627842_at:514:399; Interrogation_Position=212; Antisense; GACACCTCAAGTGCAATCCCATGGA
>probe:Drosophila_2:1627842_at:177:45; Interrogation_Position=227; Antisense; ATCCCATGGAGGCACAGCTCTTTAT
>probe:Drosophila_2:1627842_at:19:645; Interrogation_Position=245; Antisense; TCTTTATGACAGAGTGGGCCCGATA
>probe:Drosophila_2:1627842_at:482:595; Interrogation_Position=259; Antisense; TGGGCCCGATATGCGTCCACAATCA
>probe:Drosophila_2:1627842_at:525:239; Interrogation_Position=279; Antisense; AATCACCCAACAACTAGGGATTCGG
>probe:Drosophila_2:1627842_at:188:325; Interrogation_Position=326; Antisense; GCGAAGAGATTGACCCCAAGACTGT
>probe:Drosophila_2:1627842_at:490:409; Interrogation_Position=364; Antisense; GACGACCAAGTAGTCCAACTATACG
>probe:Drosophila_2:1627842_at:239:687; Interrogation_Position=383; Antisense; TATACGAGCTGATGCTGGCGGCCAA
>probe:Drosophila_2:1627842_at:144:17; Interrogation_Position=82; Antisense; ATTTTGATGAGCCAACTGACCCACC

Paste this into a BLAST search page for me
AGAGGGTCCGACTGCTGTACAAAACGTACAAAACGATCTTGCGACTGCACGACTGCACAGAGGACTTCCAGCGGAGGAACTTCGTGCTCTGGGCGATAACAACTATGTGCGGGACGAGTTCCGGCGACACCTCAAGTGCAATCCCATGGAATCCCATGGAGGCACAGCTCTTTATTCTTTATGACAGAGTGGGCCCGATATGGGCCCGATATGCGTCCACAATCAAATCACCCAACAACTAGGGATTCGGGCGAAGAGATTGACCCCAAGACTGTGACGACCAAGTAGTCCAACTATACGTATACGAGCTGATGCTGGCGGCCAAATTTTGATGAGCCAACTGACCCACC

Full Affymetrix probeset data:

Annotations for 1627842_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720