FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627844_at:

>probe:Drosophila_2:1627844_at:219:531; Interrogation_Position=1274; Antisense; GGGTCTCGTGATGCTGGGTTATAAC
>probe:Drosophila_2:1627844_at:313:533; Interrogation_Position=1304; Antisense; GGTGTTCAAAGATCCCCACAAGTTC
>probe:Drosophila_2:1627844_at:359:161; Interrogation_Position=1321; Antisense; ACAAGTTCCGACCTGAGCGCTTTGA
>probe:Drosophila_2:1627844_at:150:553; Interrogation_Position=1359; Antisense; GGACCTTTTGAGTATGTACCCTTCA
>probe:Drosophila_2:1627844_at:416:471; Interrogation_Position=1415; Antisense; GTTCGCCCTGCTGGAGATTAAGACT
>probe:Drosophila_2:1627844_at:487:73; Interrogation_Position=1458; Antisense; AGGAACTTCGAGGTGCTTCCTGCTC
>probe:Drosophila_2:1627844_at:458:685; Interrogation_Position=1511; Antisense; TATAAGCACCACTATTGGACTCCCT
>probe:Drosophila_2:1627844_at:84:729; Interrogation_Position=1525; Antisense; TTGGACTCCCTGATGCCGAGAGGAA
>probe:Drosophila_2:1627844_at:193:561; Interrogation_Position=1546; Antisense; GGAAGAAGCGCGATCCATACCGTCA
>probe:Drosophila_2:1627844_at:308:157; Interrogation_Position=1572; Antisense; AAATACGACCCTATTCTTTCCGCTG
>probe:Drosophila_2:1627844_at:44:287; Interrogation_Position=1594; Antisense; CTGTGCTGACCCTGAAATCCGAAAA
>probe:Drosophila_2:1627844_at:355:65; Interrogation_Position=1618; Antisense; ATGGTCTATACATTCGGCTGAAGGA
>probe:Drosophila_2:1627844_at:100:1; Interrogation_Position=1709; Antisense; TTTTTTAGGTATGCCGTCCCCACAG
>probe:Drosophila_2:1627844_at:170:317; Interrogation_Position=1721; Antisense; GCCGTCCCCACAGATACAATTATTA

Paste this into a BLAST search page for me
GGGTCTCGTGATGCTGGGTTATAACGGTGTTCAAAGATCCCCACAAGTTCACAAGTTCCGACCTGAGCGCTTTGAGGACCTTTTGAGTATGTACCCTTCAGTTCGCCCTGCTGGAGATTAAGACTAGGAACTTCGAGGTGCTTCCTGCTCTATAAGCACCACTATTGGACTCCCTTTGGACTCCCTGATGCCGAGAGGAAGGAAGAAGCGCGATCCATACCGTCAAAATACGACCCTATTCTTTCCGCTGCTGTGCTGACCCTGAAATCCGAAAAATGGTCTATACATTCGGCTGAAGGATTTTTTAGGTATGCCGTCCCCACAGGCCGTCCCCACAGATACAATTATTA

Full Affymetrix probeset data:

Annotations for 1627844_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720