FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627845_at:

>probe:Drosophila_2:1627845_at:186:389; Interrogation_Position=323; Antisense; GACAACCGGCTTTGGTGGAGTCCCT
>probe:Drosophila_2:1627845_at:533:587; Interrogation_Position=338; Antisense; TGGAGTCCCTGGTCATTGCCGAGTA
>probe:Drosophila_2:1627845_at:330:277; Interrogation_Position=394; Antisense; CTTTTCCCCAAGGATCCATTGCAAA
>probe:Drosophila_2:1627845_at:252:577; Interrogation_Position=420; Antisense; GGCGCTAGACAGGATTCTCATCGAA
>probe:Drosophila_2:1627845_at:518:251; Interrogation_Position=558; Antisense; CAAGCGCGGAACACCATACTTTGGA
>probe:Drosophila_2:1627845_at:670:451; Interrogation_Position=591; Antisense; GATCGGCATTGCTGACTACATGATT
>probe:Drosophila_2:1627845_at:430:459; Interrogation_Position=612; Antisense; GATTTGGCCCTGGTTCGAGCGATTC
>probe:Drosophila_2:1627845_at:298:89; Interrogation_Position=647; Antisense; AGTACACTCTGGATGAACCCTACGA
>probe:Drosophila_2:1627845_at:245:429; Interrogation_Position=670; Antisense; GAGTTGGACAAGACACGCTATCAGA
>probe:Drosophila_2:1627845_at:115:443; Interrogation_Position=727; Antisense; GATGAGGCTGTCAAGGCCACCGCTT
>probe:Drosophila_2:1627845_at:501:447; Interrogation_Position=754; Antisense; GATGCCCGAATCCATGCGAAGTTCA
>probe:Drosophila_2:1627845_at:614:613; Interrogation_Position=779; Antisense; TGAAGACCCGCCATGAGAACAAACC
>probe:Drosophila_2:1627845_at:209:131; Interrogation_Position=800; Antisense; AACCGGACTACGATGTAGCCTTCCA
>probe:Drosophila_2:1627845_at:255:127; Interrogation_Position=816; Antisense; AGCCTTCCAGCCCTTGTAAAGGATG

Paste this into a BLAST search page for me
GACAACCGGCTTTGGTGGAGTCCCTTGGAGTCCCTGGTCATTGCCGAGTACTTTTCCCCAAGGATCCATTGCAAAGGCGCTAGACAGGATTCTCATCGAACAAGCGCGGAACACCATACTTTGGAGATCGGCATTGCTGACTACATGATTGATTTGGCCCTGGTTCGAGCGATTCAGTACACTCTGGATGAACCCTACGAGAGTTGGACAAGACACGCTATCAGAGATGAGGCTGTCAAGGCCACCGCTTGATGCCCGAATCCATGCGAAGTTCATGAAGACCCGCCATGAGAACAAACCAACCGGACTACGATGTAGCCTTCCAAGCCTTCCAGCCCTTGTAAAGGATG

Full Affymetrix probeset data:

Annotations for 1627845_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720