Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627847_s_at:

>probe:Drosophila_2:1627847_s_at:29:67; Interrogation_Position=1006; Antisense; ATGGACGACGAGACCTCTGTATCGC
>probe:Drosophila_2:1627847_s_at:88:685; Interrogation_Position=1025; Antisense; TATCGCCGGCCAGCAATTTCTAGAT
>probe:Drosophila_2:1627847_s_at:174:99; Interrogation_Position=1046; Antisense; AGATCCTCCTACTATCTACATGTAC
>probe:Drosophila_2:1627847_s_at:555:683; Interrogation_Position=1106; Antisense; TATAAATGAATGGTGGCTGCTCCAC
>probe:Drosophila_2:1627847_s_at:313:99; Interrogation_Position=576; Antisense; AGATGACCGCATTTACTGCTGCGCA
>probe:Drosophila_2:1627847_s_at:39:521; Interrogation_Position=649; Antisense; GTGGCAAATCTAGTCCGGGATCGCG
>probe:Drosophila_2:1627847_s_at:242:109; Interrogation_Position=677; Antisense; AGAATGTGACCGTGTCCCAGGTGCG
>probe:Drosophila_2:1627847_s_at:413:301; Interrogation_Position=692; Antisense; CCCAGGTGCGGGACATGTTTTGCGA
>probe:Drosophila_2:1627847_s_at:422:299; Interrogation_Position=729; Antisense; CGCCGAATCCCCAAATGTCATGATA
>probe:Drosophila_2:1627847_s_at:521:521; Interrogation_Position=771; Antisense; GGGCCTTCACTTATTCAGCATGGAG
>probe:Drosophila_2:1627847_s_at:339:385; Interrogation_Position=846; Antisense; GAACATTGTGGACTTTCTCTCGAAA
>probe:Drosophila_2:1627847_s_at:492:57; Interrogation_Position=878; Antisense; ATGATTTCATAAACCTCAGCGAGGC
>probe:Drosophila_2:1627847_s_at:368:393; Interrogation_Position=943; Antisense; GAAATGTGCACCATCTATAGGGCTA
>probe:Drosophila_2:1627847_s_at:129:187; Interrogation_Position=980; Antisense; AACAAGGTGCCAACATGGACTTCGA

Paste this into a BLAST search page for me
ATGGACGACGAGACCTCTGTATCGCTATCGCCGGCCAGCAATTTCTAGATAGATCCTCCTACTATCTACATGTACTATAAATGAATGGTGGCTGCTCCACAGATGACCGCATTTACTGCTGCGCAGTGGCAAATCTAGTCCGGGATCGCGAGAATGTGACCGTGTCCCAGGTGCGCCCAGGTGCGGGACATGTTTTGCGACGCCGAATCCCCAAATGTCATGATAGGGCCTTCACTTATTCAGCATGGAGGAACATTGTGGACTTTCTCTCGAAAATGATTTCATAAACCTCAGCGAGGCGAAATGTGCACCATCTATAGGGCTAAACAAGGTGCCAACATGGACTTCGA

Full Affymetrix probeset data:

Annotations for 1627847_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime