Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627849_at:

>probe:Drosophila_2:1627849_at:494:179; Interrogation_Position=1161; Antisense; AAACAGGATCATCGACAGGGCTTGA
>probe:Drosophila_2:1627849_at:664:713; Interrogation_Position=1202; Antisense; TTCTATGGATGCACGTGCCGCTGGC
>probe:Drosophila_2:1627849_at:93:297; Interrogation_Position=1220; Antisense; CGCTGGCTTCAAGTATCCTCGAAAA
>probe:Drosophila_2:1627849_at:534:261; Interrogation_Position=1270; Antisense; CAGCTGACTGTTTTATGCCGTTGGA
>probe:Drosophila_2:1627849_at:368:103; Interrogation_Position=1294; Antisense; AGAGCGTGGATTCATTGCCCCATGA
>probe:Drosophila_2:1627849_at:490:531; Interrogation_Position=1334; Antisense; GGGTGGTGTAACCATACCAGCTCCT
>probe:Drosophila_2:1627849_at:723:87; Interrogation_Position=1367; Antisense; AGATACTCAATTTCCCACGTACTTA
>probe:Drosophila_2:1627849_at:299:521; Interrogation_Position=1429; Antisense; GGGCGATAATCATCCGGTTTCAGTT
>probe:Drosophila_2:1627849_at:212:479; Interrogation_Position=1445; Antisense; GTTTCAGTTCGGTTTCAAGATCAGC
>probe:Drosophila_2:1627849_at:218:453; Interrogation_Position=1463; Antisense; GATCAGCGCCGTTAAATCTAGTTTA
>probe:Drosophila_2:1627849_at:591:59; Interrogation_Position=1496; Antisense; ATGTTTTCATTTGGGCAGTTCACTA
>probe:Drosophila_2:1627849_at:588:661; Interrogation_Position=1522; Antisense; TAACTTGTCTACAGGACTTCGCAGA
>probe:Drosophila_2:1627849_at:551:169; Interrogation_Position=1568; Antisense; AAAGTTATGCAACTCCTGTCCACTT
>probe:Drosophila_2:1627849_at:450:631; Interrogation_Position=1581; Antisense; TCCTGTCCACTTGTTTGCTATAGTA

Paste this into a BLAST search page for me
AAACAGGATCATCGACAGGGCTTGATTCTATGGATGCACGTGCCGCTGGCCGCTGGCTTCAAGTATCCTCGAAAACAGCTGACTGTTTTATGCCGTTGGAAGAGCGTGGATTCATTGCCCCATGAGGGTGGTGTAACCATACCAGCTCCTAGATACTCAATTTCCCACGTACTTAGGGCGATAATCATCCGGTTTCAGTTGTTTCAGTTCGGTTTCAAGATCAGCGATCAGCGCCGTTAAATCTAGTTTAATGTTTTCATTTGGGCAGTTCACTATAACTTGTCTACAGGACTTCGCAGAAAAGTTATGCAACTCCTGTCCACTTTCCTGTCCACTTGTTTGCTATAGTA

Full Affymetrix probeset data:

Annotations for 1627849_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime