Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627850_at:

>probe:Drosophila_2:1627850_at:209:171; Interrogation_Position=1616; Antisense; AAAGTGCCGGTCATGCTTTGCAAGT
>probe:Drosophila_2:1627850_at:581:159; Interrogation_Position=1688; Antisense; AAACGAAACGCATACGACTCTTTAT
>probe:Drosophila_2:1627850_at:426:405; Interrogation_Position=1703; Antisense; GACTCTTTATATCATACGGCTGCGA
>probe:Drosophila_2:1627850_at:548:469; Interrogation_Position=1799; Antisense; GTTCGTTGATATCTCTACATACATG
>probe:Drosophila_2:1627850_at:134:245; Interrogation_Position=1824; Antisense; AATTCTGTCTCTATCGTTTTCCGTA
>probe:Drosophila_2:1627850_at:473:475; Interrogation_Position=1839; Antisense; GTTTTCCGTAATCTAGCACTATTTG
>probe:Drosophila_2:1627850_at:577:15; Interrogation_Position=1876; Antisense; ATTATAAGCTTGTTGCTGCGCCATT
>probe:Drosophila_2:1627850_at:507:335; Interrogation_Position=1890; Antisense; GCTGCGCCATTATTCGAGCTATACG
>probe:Drosophila_2:1627850_at:206:25; Interrogation_Position=1928; Antisense; ATATGGACCCATTATCTCATCTCTG
>probe:Drosophila_2:1627850_at:394:69; Interrogation_Position=1957; Antisense; AGGCCCTCTGCAGATTCAACTTTAT
>probe:Drosophila_2:1627850_at:392:513; Interrogation_Position=2007; Antisense; GGGCCCACGTCCAGCAATAGTTAAG
>probe:Drosophila_2:1627850_at:494:457; Interrogation_Position=2060; Antisense; GATAGCGCTACCTAACTGATTTCAG
>probe:Drosophila_2:1627850_at:682:119; Interrogation_Position=2096; Antisense; AGCCCGTAGATTTCCATTTCATGTG
>probe:Drosophila_2:1627850_at:157:175; Interrogation_Position=2160; Antisense; AAAGCCAGTCTCTTTCACTTGGCAA

Paste this into a BLAST search page for me
AAAGTGCCGGTCATGCTTTGCAAGTAAACGAAACGCATACGACTCTTTATGACTCTTTATATCATACGGCTGCGAGTTCGTTGATATCTCTACATACATGAATTCTGTCTCTATCGTTTTCCGTAGTTTTCCGTAATCTAGCACTATTTGATTATAAGCTTGTTGCTGCGCCATTGCTGCGCCATTATTCGAGCTATACGATATGGACCCATTATCTCATCTCTGAGGCCCTCTGCAGATTCAACTTTATGGGCCCACGTCCAGCAATAGTTAAGGATAGCGCTACCTAACTGATTTCAGAGCCCGTAGATTTCCATTTCATGTGAAAGCCAGTCTCTTTCACTTGGCAA

Full Affymetrix probeset data:

Annotations for 1627850_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime