Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627851_at:

>probe:Drosophila_2:1627851_at:437:223; Interrogation_Position=1491; Antisense; AAGGTGTTTGTATTTGCCTCAGAGC
>probe:Drosophila_2:1627851_at:618:419; Interrogation_Position=1512; Antisense; GAGCATCTTCCCATCATGATAGCAG
>probe:Drosophila_2:1627851_at:516:189; Interrogation_Position=1565; Antisense; AAGATACGTGGGTTCGCCCTTTCTG
>probe:Drosophila_2:1627851_at:673:591; Interrogation_Position=1588; Antisense; TGGGTGTTCCCTTCGCTAGCGAGAA
>probe:Drosophila_2:1627851_at:437:675; Interrogation_Position=1604; Antisense; TAGCGAGAACTTGGAGGCCCGCCTG
>probe:Drosophila_2:1627851_at:168:135; Interrogation_Position=1631; Antisense; ACGCTGGCCGGGATTGCAATGCAAG
>probe:Drosophila_2:1627851_at:9:197; Interrogation_Position=1707; Antisense; AACTGTGATATTACGCTCAGCTCTG
>probe:Drosophila_2:1627851_at:420:145; Interrogation_Position=1762; Antisense; ACTCGGAGTGTCGTCTACGGGCCTG
>probe:Drosophila_2:1627851_at:536:161; Interrogation_Position=1793; Antisense; AAAGGCGGCAGGGATTTACAGACGT
>probe:Drosophila_2:1627851_at:231:667; Interrogation_Position=1809; Antisense; TACAGACGTGAACCGGCTTTAATAC
>probe:Drosophila_2:1627851_at:269:709; Interrogation_Position=1827; Antisense; TTAATACCTTTAGCCGATCGATTGG
>probe:Drosophila_2:1627851_at:207:149; Interrogation_Position=1861; Antisense; ACATAAGGTATTCCCTGGCCTACAA
>probe:Drosophila_2:1627851_at:270:693; Interrogation_Position=1995; Antisense; TTTGCACCGCTTTAGTTATTTTCAG
>probe:Drosophila_2:1627851_at:606:475; Interrogation_Position=2009; Antisense; GTTATTTTCAGCATACCCCGATTTT

Paste this into a BLAST search page for me
AAGGTGTTTGTATTTGCCTCAGAGCGAGCATCTTCCCATCATGATAGCAGAAGATACGTGGGTTCGCCCTTTCTGTGGGTGTTCCCTTCGCTAGCGAGAATAGCGAGAACTTGGAGGCCCGCCTGACGCTGGCCGGGATTGCAATGCAAGAACTGTGATATTACGCTCAGCTCTGACTCGGAGTGTCGTCTACGGGCCTGAAAGGCGGCAGGGATTTACAGACGTTACAGACGTGAACCGGCTTTAATACTTAATACCTTTAGCCGATCGATTGGACATAAGGTATTCCCTGGCCTACAATTTGCACCGCTTTAGTTATTTTCAGGTTATTTTCAGCATACCCCGATTTT

Full Affymetrix probeset data:

Annotations for 1627851_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime