Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627852_at:

>probe:Drosophila_2:1627852_at:191:77; Interrogation_Position=1597; Antisense; AGGAGGCACTGCTTTCGCAGTCAAT
>probe:Drosophila_2:1627852_at:133:403; Interrogation_Position=1626; Antisense; GACATTGTCGTTGAGCAGTGCCAAA
>probe:Drosophila_2:1627852_at:604:549; Interrogation_Position=1682; Antisense; GGAGGGACAGCTCATATCCCTACAG
>probe:Drosophila_2:1627852_at:575:121; Interrogation_Position=1705; Antisense; AGCCGGTTGCGGTGGTACACTTCAG
>probe:Drosophila_2:1627852_at:519:109; Interrogation_Position=1767; Antisense; AGAATCTACTCACCGCAACAAACAG
>probe:Drosophila_2:1627852_at:685:101; Interrogation_Position=1790; Antisense; AGAGCTACCTAGTTCCGATGGCGAA
>probe:Drosophila_2:1627852_at:154:441; Interrogation_Position=1806; Antisense; GATGGCGAAGTCTTCCAGCGCTTTT
>probe:Drosophila_2:1627852_at:452:119; Interrogation_Position=1822; Antisense; AGCGCTTTTTGATGGACGCCACGTA
>probe:Drosophila_2:1627852_at:376:17; Interrogation_Position=1895; Antisense; ATTTTACATTGTTTGCACTTCCCCA
>probe:Drosophila_2:1627852_at:367:617; Interrogation_Position=1908; Antisense; TGCACTTCCCCAAAGGCGATCTAAT
>probe:Drosophila_2:1627852_at:34:453; Interrogation_Position=1925; Antisense; GATCTAATCAATTCCTAAGCACCCC
>probe:Drosophila_2:1627852_at:603:465; Interrogation_Position=2003; Antisense; GTTGTTTTATCTCAGCCAAGTGTAA
>probe:Drosophila_2:1627852_at:122:143; Interrogation_Position=2032; Antisense; ACTAGGACCCGACTTGTTTGCAATA
>probe:Drosophila_2:1627852_at:494:201; Interrogation_Position=2123; Antisense; AACCCGAGCGCTGAGTTGAGGCGAA

Paste this into a BLAST search page for me
AGGAGGCACTGCTTTCGCAGTCAATGACATTGTCGTTGAGCAGTGCCAAAGGAGGGACAGCTCATATCCCTACAGAGCCGGTTGCGGTGGTACACTTCAGAGAATCTACTCACCGCAACAAACAGAGAGCTACCTAGTTCCGATGGCGAAGATGGCGAAGTCTTCCAGCGCTTTTAGCGCTTTTTGATGGACGCCACGTAATTTTACATTGTTTGCACTTCCCCATGCACTTCCCCAAAGGCGATCTAATGATCTAATCAATTCCTAAGCACCCCGTTGTTTTATCTCAGCCAAGTGTAAACTAGGACCCGACTTGTTTGCAATAAACCCGAGCGCTGAGTTGAGGCGAA

Full Affymetrix probeset data:

Annotations for 1627852_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime