FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627854_at:

>probe:Drosophila_2:1627854_at:151:281; Interrogation_Position=1070; Antisense; CTCATTATTATCTTGCTGCTGCGTT
>probe:Drosophila_2:1627854_at:201:227; Interrogation_Position=529; Antisense; AAGGCCAATGTTTTGGTCTCGCATC
>probe:Drosophila_2:1627854_at:495:489; Interrogation_Position=567; Antisense; GTACTACGTGCCTCTGGTCGAGATC
>probe:Drosophila_2:1627854_at:331:103; Interrogation_Position=629; Antisense; AGACCCGTGCCCTGATGGAGGAGAT
>probe:Drosophila_2:1627854_at:97:83; Interrogation_Position=661; Antisense; AAACCAGTTACGCTGTCGCGGGAGA
>probe:Drosophila_2:1627854_at:174:267; Interrogation_Position=712; Antisense; CAGTATGCCATCCTGAACGAGACAT
>probe:Drosophila_2:1627854_at:540:637; Interrogation_Position=746; Antisense; TCGAGGCCGGCATCCTGAATGTCAA
>probe:Drosophila_2:1627854_at:693:607; Interrogation_Position=788; Antisense; TGAGCAATGGACTGGGACCGCGCTA
>probe:Drosophila_2:1627854_at:148:549; Interrogation_Position=831; Antisense; GGAGACGGCCCATCTGAATGCCGAG
>probe:Drosophila_2:1627854_at:420:69; Interrogation_Position=859; Antisense; ATGGCCAACTATTTCGAACGCTACT
>probe:Drosophila_2:1627854_at:39:383; Interrogation_Position=874; Antisense; GAACGCTACTCGAACACCATCTATG
>probe:Drosophila_2:1627854_at:416:129; Interrogation_Position=889; Antisense; ACCATCTATGCGGTTAGCGAGACAA
>probe:Drosophila_2:1627854_at:508:395; Interrogation_Position=907; Antisense; GAGACAATGGGACCGACACCGAAAA
>probe:Drosophila_2:1627854_at:198:535; Interrogation_Position=978; Antisense; GGTGCCGCTGGATCAGTTGGCCCAA

Paste this into a BLAST search page for me
CTCATTATTATCTTGCTGCTGCGTTAAGGCCAATGTTTTGGTCTCGCATCGTACTACGTGCCTCTGGTCGAGATCAGACCCGTGCCCTGATGGAGGAGATAAACCAGTTACGCTGTCGCGGGAGACAGTATGCCATCCTGAACGAGACATTCGAGGCCGGCATCCTGAATGTCAATGAGCAATGGACTGGGACCGCGCTAGGAGACGGCCCATCTGAATGCCGAGATGGCCAACTATTTCGAACGCTACTGAACGCTACTCGAACACCATCTATGACCATCTATGCGGTTAGCGAGACAAGAGACAATGGGACCGACACCGAAAAGGTGCCGCTGGATCAGTTGGCCCAA

Full Affymetrix probeset data:

Annotations for 1627854_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720