Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627855_at:

>probe:Drosophila_2:1627855_at:589:49; Interrogation_Position=1256; Antisense; ATGCCATAGCCTCGAAGTTCCATCG
>probe:Drosophila_2:1627855_at:189:45; Interrogation_Position=1277; Antisense; ATCGCTTCTTCCTCAAGAACCTGAA
>probe:Drosophila_2:1627855_at:672:705; Interrogation_Position=1328; Antisense; TTAGGCTAGAACTGCCCGCTGGGAA
>probe:Drosophila_2:1627855_at:433:593; Interrogation_Position=1347; Antisense; TGGGAACTCGCTGCTGGGTCATCGA
>probe:Drosophila_2:1627855_at:212:475; Interrogation_Position=1420; Antisense; GTTTTCAATACTCACGGTCAGGCCT
>probe:Drosophila_2:1627855_at:457:409; Interrogation_Position=1446; Antisense; GACGAATGCCCTGCAAACGTACTTC
>probe:Drosophila_2:1627855_at:580:693; Interrogation_Position=1513; Antisense; TTTAAGTTCGAGACCGGCGGCATTG
>probe:Drosophila_2:1627855_at:264:345; Interrogation_Position=1532; Antisense; GCATTGTCAACTATTCTGCTCGCAA
>probe:Drosophila_2:1627855_at:588:359; Interrogation_Position=1553; Antisense; GCAATCCGTTTACCGCTTTGAATCA
>probe:Drosophila_2:1627855_at:411:227; Interrogation_Position=1600; Antisense; AAGGCGACCAGGGACAACTTCCAGC
>probe:Drosophila_2:1627855_at:196:191; Interrogation_Position=1615; Antisense; AACTTCCAGCGGTCCTATTTGGACA
>probe:Drosophila_2:1627855_at:46:475; Interrogation_Position=1721; Antisense; GTTACTACTATCAGCGGACCACGAG
>probe:Drosophila_2:1627855_at:210:613; Interrogation_Position=1762; Antisense; TGAAAGACAACTCGCGTACACTCTG
>probe:Drosophila_2:1627855_at:397:483; Interrogation_Position=1788; Antisense; GTATACGCAATGCTCGCATCAGCTG

Paste this into a BLAST search page for me
ATGCCATAGCCTCGAAGTTCCATCGATCGCTTCTTCCTCAAGAACCTGAATTAGGCTAGAACTGCCCGCTGGGAATGGGAACTCGCTGCTGGGTCATCGAGTTTTCAATACTCACGGTCAGGCCTGACGAATGCCCTGCAAACGTACTTCTTTAAGTTCGAGACCGGCGGCATTGGCATTGTCAACTATTCTGCTCGCAAGCAATCCGTTTACCGCTTTGAATCAAAGGCGACCAGGGACAACTTCCAGCAACTTCCAGCGGTCCTATTTGGACAGTTACTACTATCAGCGGACCACGAGTGAAAGACAACTCGCGTACACTCTGGTATACGCAATGCTCGCATCAGCTG

Full Affymetrix probeset data:

Annotations for 1627855_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime