FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627856_at:

>probe:Drosophila_2:1627856_at:448:209; Interrogation_Position=433; Antisense; AAGAATTCAGTTTCCGTGCATTTCG
>probe:Drosophila_2:1627856_at:435:509; Interrogation_Position=448; Antisense; GTGCATTTCGGTAATAGCCTCGGTG
>probe:Drosophila_2:1627856_at:334:535; Interrogation_Position=469; Antisense; GGTGCTTACGTCGTCTTCAACAGAA
>probe:Drosophila_2:1627856_at:728:533; Interrogation_Position=505; Antisense; GGTGCACGATGTTCCAGTGACCATA
>probe:Drosophila_2:1627856_at:564:85; Interrogation_Position=520; Antisense; AGTGACCATAATCCCGGGCAGCGAT
>probe:Drosophila_2:1627856_at:265:123; Interrogation_Position=539; Antisense; AGCGATTGGTCTGCCTACGTTGTAC
>probe:Drosophila_2:1627856_at:182:175; Interrogation_Position=574; Antisense; AAACTCACAGTTGGCTTTGGGCCTA
>probe:Drosophila_2:1627856_at:194:377; Interrogation_Position=637; Antisense; GAAGAATATATCACCCAGCCTGGAG
>probe:Drosophila_2:1627856_at:722:489; Interrogation_Position=692; Antisense; GTAATAGCCACCTCTGAAATGTCCA
>probe:Drosophila_2:1627856_at:257:505; Interrogation_Position=712; Antisense; GTCCACTGTGACTAGTCGATTCCAG
>probe:Drosophila_2:1627856_at:581:195; Interrogation_Position=751; Antisense; AACTGTGTCAGGATCCCAGCAGGAA
>probe:Drosophila_2:1627856_at:189:379; Interrogation_Position=773; Antisense; GAAGCGTCCTGCTCTGTGGATTCAA
>probe:Drosophila_2:1627856_at:130:513; Interrogation_Position=864; Antisense; GTGAGCATTCCATCCATCTGCAGAT
>probe:Drosophila_2:1627856_at:577:399; Interrogation_Position=897; Antisense; GACAGGATGTGGTTCTGCACTCTAT

Paste this into a BLAST search page for me
AAGAATTCAGTTTCCGTGCATTTCGGTGCATTTCGGTAATAGCCTCGGTGGGTGCTTACGTCGTCTTCAACAGAAGGTGCACGATGTTCCAGTGACCATAAGTGACCATAATCCCGGGCAGCGATAGCGATTGGTCTGCCTACGTTGTACAAACTCACAGTTGGCTTTGGGCCTAGAAGAATATATCACCCAGCCTGGAGGTAATAGCCACCTCTGAAATGTCCAGTCCACTGTGACTAGTCGATTCCAGAACTGTGTCAGGATCCCAGCAGGAAGAAGCGTCCTGCTCTGTGGATTCAAGTGAGCATTCCATCCATCTGCAGATGACAGGATGTGGTTCTGCACTCTAT

Full Affymetrix probeset data:

Annotations for 1627856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720