FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627859_at:

>probe:Drosophila_2:1627859_at:165:27; Interrogation_Position=2324; Antisense; ATACCCTTATAAATCGTGTTGGCCG
>probe:Drosophila_2:1627859_at:153:639; Interrogation_Position=2337; Antisense; TCGTGTTGGCCGAAGAACTATTATT
>probe:Drosophila_2:1627859_at:517:597; Interrogation_Position=2364; Antisense; TGTGCTATGTGGAAAGTTGCTTACT
>probe:Drosophila_2:1627859_at:556:471; Interrogation_Position=2445; Antisense; GTTCATGGGAACTGGGATTCGCAAC
>probe:Drosophila_2:1627859_at:517:255; Interrogation_Position=2512; Antisense; CAAAGAATGTTTTAGGCCAAGTGCA
>probe:Drosophila_2:1627859_at:132:581; Interrogation_Position=2526; Antisense; GGCCAAGTGCATCAGTTGCTGTTTA
>probe:Drosophila_2:1627859_at:636:241; Interrogation_Position=2622; Antisense; AATAGCAGCAGGTGCGCGTGTCTAC
>probe:Drosophila_2:1627859_at:198:329; Interrogation_Position=2637; Antisense; GCGTGTCTACAGCATGAGACTCGAA
>probe:Drosophila_2:1627859_at:278:323; Interrogation_Position=2662; Antisense; GCGAGTTTAGATCTAAGTCACCGAA
>probe:Drosophila_2:1627859_at:16:17; Interrogation_Position=2707; Antisense; ATTTTTACTATTAGCCCAGTTCTAG
>probe:Drosophila_2:1627859_at:351:319; Interrogation_Position=2720; Antisense; GCCCAGTTCTAGCTTAGTTTCCAAG
>probe:Drosophila_2:1627859_at:198:63; Interrogation_Position=2735; Antisense; AGTTTCCAAGCACTGCAAGCTGTAT
>probe:Drosophila_2:1627859_at:696:659; Interrogation_Position=2803; Antisense; TAAAATGCCGTCTTAAATCTTGTAA
>probe:Drosophila_2:1627859_at:120:257; Interrogation_Position=2837; Antisense; CTTCGAAATGTGTCGTTTTTTGGTG

Paste this into a BLAST search page for me
ATACCCTTATAAATCGTGTTGGCCGTCGTGTTGGCCGAAGAACTATTATTTGTGCTATGTGGAAAGTTGCTTACTGTTCATGGGAACTGGGATTCGCAACCAAAGAATGTTTTAGGCCAAGTGCAGGCCAAGTGCATCAGTTGCTGTTTAAATAGCAGCAGGTGCGCGTGTCTACGCGTGTCTACAGCATGAGACTCGAAGCGAGTTTAGATCTAAGTCACCGAAATTTTTACTATTAGCCCAGTTCTAGGCCCAGTTCTAGCTTAGTTTCCAAGAGTTTCCAAGCACTGCAAGCTGTATTAAAATGCCGTCTTAAATCTTGTAACTTCGAAATGTGTCGTTTTTTGGTG

Full Affymetrix probeset data:

Annotations for 1627859_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720