FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627860_at:

>probe:Drosophila_2:1627860_at:76:545; Interrogation_Position=1031; Antisense; GGATAACCGCGGACAGGAGCTACAA
>probe:Drosophila_2:1627860_at:645:211; Interrogation_Position=1054; Antisense; AAGTCGGCGGTTCTGTATTTCCTGC
>probe:Drosophila_2:1627860_at:416:281; Interrogation_Position=1113; Antisense; CTCCATATTTCCCATTTCGGTGCAG
>probe:Drosophila_2:1627860_at:80:217; Interrogation_Position=1156; Antisense; AAGTTCGCGTTCACAATCATCACAA
>probe:Drosophila_2:1627860_at:521:627; Interrogation_Position=670; Antisense; TGCCACCTGGCTATTCTCAGAGATC
>probe:Drosophila_2:1627860_at:678:531; Interrogation_Position=753; Antisense; GGTGGCCTGCATTCAGGATCATCGA
>probe:Drosophila_2:1627860_at:102:31; Interrogation_Position=784; Antisense; ATACAGTGCTCCCAGATTATTCGAC
>probe:Drosophila_2:1627860_at:275:599; Interrogation_Position=815; Antisense; TGTCGATCACTATCTTTGCCCAGTT
>probe:Drosophila_2:1627860_at:324:621; Interrogation_Position=842; Antisense; TGCTGGTTGGCATTGACTTGGGTCT
>probe:Drosophila_2:1627860_at:631:641; Interrogation_Position=884; Antisense; TCTTCTTTCCGAACACCATTTGGAC
>probe:Drosophila_2:1627860_at:715:175; Interrogation_Position=918; Antisense; AAACGTGTCGTTCATCGTGGCCATC
>probe:Drosophila_2:1627860_at:730:39; Interrogation_Position=940; Antisense; ATCTGTACAGAGTCCTTTCCATGCT
>probe:Drosophila_2:1627860_at:257:621; Interrogation_Position=968; Antisense; TGCTCTGCGAGCATCTGATCGAGGA
>probe:Drosophila_2:1627860_at:601:437; Interrogation_Position=988; Antisense; GAGGACTCCGTCCATGTGAGCAACG

Paste this into a BLAST search page for me
GGATAACCGCGGACAGGAGCTACAAAAGTCGGCGGTTCTGTATTTCCTGCCTCCATATTTCCCATTTCGGTGCAGAAGTTCGCGTTCACAATCATCACAATGCCACCTGGCTATTCTCAGAGATCGGTGGCCTGCATTCAGGATCATCGAATACAGTGCTCCCAGATTATTCGACTGTCGATCACTATCTTTGCCCAGTTTGCTGGTTGGCATTGACTTGGGTCTTCTTCTTTCCGAACACCATTTGGACAAACGTGTCGTTCATCGTGGCCATCATCTGTACAGAGTCCTTTCCATGCTTGCTCTGCGAGCATCTGATCGAGGAGAGGACTCCGTCCATGTGAGCAACG

Full Affymetrix probeset data:

Annotations for 1627860_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720