FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627862_at:

>probe:Drosophila_2:1627862_at:610:63; Interrogation_Position=2406; Antisense; ATGTGTCCACATTGCGGCGAGTACC
>probe:Drosophila_2:1627862_at:656:175; Interrogation_Position=2433; Antisense; AAACTGGAGTGGTTCTGGGCCTTCA
>probe:Drosophila_2:1627862_at:448:139; Interrogation_Position=2460; Antisense; ACGTCGCTCATCGATTGCGAACTCA
>probe:Drosophila_2:1627862_at:691:99; Interrogation_Position=2491; Antisense; AGAGGTGCAAACTGTACGCGGCCAT
>probe:Drosophila_2:1627862_at:26:203; Interrogation_Position=2529; Antisense; AACCAACTGATGGATCTGCACGAGT
>probe:Drosophila_2:1627862_at:654:185; Interrogation_Position=2640; Antisense; AACAAACTGGGCTCCATCCTCAGAT
>probe:Drosophila_2:1627862_at:172:625; Interrogation_Position=2671; Antisense; TGCCCAGCGTGATGGCCCAGTATGG
>probe:Drosophila_2:1627862_at:730:581; Interrogation_Position=2693; Antisense; TGGCGGACAGTCAATCGAGTACGTG
>probe:Drosophila_2:1627862_at:539:667; Interrogation_Position=2721; Antisense; TACTTCTCCTACTTCTGGGATGTGA
>probe:Drosophila_2:1627862_at:667:511; Interrogation_Position=2742; Antisense; GTGATGGCGCTGAGCAACTACAAGT
>probe:Drosophila_2:1627862_at:406:473; Interrogation_Position=2807; Antisense; GTTCATAGCCGACGAGTTCAAGGAT
>probe:Drosophila_2:1627862_at:18:671; Interrogation_Position=2847; Antisense; TACGAGGATTATATTGCGCCCAAAT
>probe:Drosophila_2:1627862_at:238:293; Interrogation_Position=2863; Antisense; CGCCCAAATTTGCTGAAGAGTCCTA
>probe:Drosophila_2:1627862_at:161:433; Interrogation_Position=2880; Antisense; GAGTCCTATGGCAGTGTCGTAGATA

Paste this into a BLAST search page for me
ATGTGTCCACATTGCGGCGAGTACCAAACTGGAGTGGTTCTGGGCCTTCAACGTCGCTCATCGATTGCGAACTCAAGAGGTGCAAACTGTACGCGGCCATAACCAACTGATGGATCTGCACGAGTAACAAACTGGGCTCCATCCTCAGATTGCCCAGCGTGATGGCCCAGTATGGTGGCGGACAGTCAATCGAGTACGTGTACTTCTCCTACTTCTGGGATGTGAGTGATGGCGCTGAGCAACTACAAGTGTTCATAGCCGACGAGTTCAAGGATTACGAGGATTATATTGCGCCCAAATCGCCCAAATTTGCTGAAGAGTCCTAGAGTCCTATGGCAGTGTCGTAGATA

Full Affymetrix probeset data:

Annotations for 1627862_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720