FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627863_at:

>probe:Drosophila_2:1627863_at:528:257; Interrogation_Position=1002; Antisense; CACATCCGTGCTCGGTGGCAAGAAC
>probe:Drosophila_2:1627863_at:27:211; Interrogation_Position=1021; Antisense; AAGAACCCGTTCCTGGGCATTGCGT
>probe:Drosophila_2:1627863_at:345:5; Interrogation_Position=1048; Antisense; ATTGTGGTGGGTGCCATTTGCATCA
>probe:Drosophila_2:1627863_at:147:287; Interrogation_Position=1081; Antisense; CTGGCCCTGCTATTTATTCATATGC
>probe:Drosophila_2:1627863_at:139:551; Interrogation_Position=1125; Antisense; GGAGATGATCAACGTGAACCCGCAC
>probe:Drosophila_2:1627863_at:567:575; Interrogation_Position=1187; Antisense; GGCCGCTTCACTTAGCTTTAGTAGA
>probe:Drosophila_2:1627863_at:606:483; Interrogation_Position=1207; Antisense; GTAGATCCATTTCTTTAAGCCTTAT
>probe:Drosophila_2:1627863_at:518:395; Interrogation_Position=685; Antisense; GACAAGCGCGTCAAGTTCCGAAACC
>probe:Drosophila_2:1627863_at:653:491; Interrogation_Position=716; Antisense; GTAACCTGAACGTCTCCCTTGAGGG
>probe:Drosophila_2:1627863_at:419:451; Interrogation_Position=823; Antisense; GATCTGATCGTGTGGATGCGCACCG
>probe:Drosophila_2:1627863_at:313:679; Interrogation_Position=872; Antisense; TATATCGCCGTCTCAACCAAACGAA
>probe:Drosophila_2:1627863_at:727:311; Interrogation_Position=907; Antisense; GCCAACGGCCTGAAGTCTGGCAATT
>probe:Drosophila_2:1627863_at:273:653; Interrogation_Position=951; Antisense; TAATTATCCGGTGGTGTCGTTCGAC
>probe:Drosophila_2:1627863_at:646:135; Interrogation_Position=979; Antisense; ACGAAGCGAATGATACTCTCCACCA

Paste this into a BLAST search page for me
CACATCCGTGCTCGGTGGCAAGAACAAGAACCCGTTCCTGGGCATTGCGTATTGTGGTGGGTGCCATTTGCATCACTGGCCCTGCTATTTATTCATATGCGGAGATGATCAACGTGAACCCGCACGGCCGCTTCACTTAGCTTTAGTAGAGTAGATCCATTTCTTTAAGCCTTATGACAAGCGCGTCAAGTTCCGAAACCGTAACCTGAACGTCTCCCTTGAGGGGATCTGATCGTGTGGATGCGCACCGTATATCGCCGTCTCAACCAAACGAAGCCAACGGCCTGAAGTCTGGCAATTTAATTATCCGGTGGTGTCGTTCGACACGAAGCGAATGATACTCTCCACCA

Full Affymetrix probeset data:

Annotations for 1627863_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720