Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627866_at:

>probe:Drosophila_2:1627866_at:407:237; Interrogation_Position=3366; Antisense; AATCGAGTGGTTACCCTGCCTAGCA
>probe:Drosophila_2:1627866_at:80:351; Interrogation_Position=3395; Antisense; GCAGAGCAACTCACAGCGTGGCCAA
>probe:Drosophila_2:1627866_at:696:329; Interrogation_Position=3410; Antisense; GCGTGGCCAATCATCTATGCGATCA
>probe:Drosophila_2:1627866_at:250:623; Interrogation_Position=3427; Antisense; TGCGATCAAACTCCAGCAGTACTGT
>probe:Drosophila_2:1627866_at:316:489; Interrogation_Position=3445; Antisense; GTACTGTCACCATTACTCAAACGAA
>probe:Drosophila_2:1627866_at:716:365; Interrogation_Position=3488; Antisense; GAATACAGCGACTCCAGGCGACGGA
>probe:Drosophila_2:1627866_at:684:195; Interrogation_Position=3528; Antisense; AACTGTGGGCAGTTGGCTAGCCAGC
>probe:Drosophila_2:1627866_at:326:337; Interrogation_Position=3543; Antisense; GCTAGCCAGCTGACGGTCCGAAAAG
>probe:Drosophila_2:1627866_at:337:307; Interrogation_Position=3578; Antisense; CCAGGGTAGACCCTTTTATGCCTGT
>probe:Drosophila_2:1627866_at:311:705; Interrogation_Position=3593; Antisense; TTATGCCTGTCCCACGCGGGAGAAG
>probe:Drosophila_2:1627866_at:438:215; Interrogation_Position=3615; Antisense; AAGTCATGCGGTTTCTTCAAATGGG
>probe:Drosophila_2:1627866_at:130:125; Interrogation_Position=3715; Antisense; AGCCCACAGCTATTACGTCCGATGG
>probe:Drosophila_2:1627866_at:475:441; Interrogation_Position=3735; Antisense; GATGGTCCCAAAACGAGACGCTGTG
>probe:Drosophila_2:1627866_at:351:411; Interrogation_Position=3751; Antisense; GACGCTGTGGTCTCTGTCGCAAGGA

Paste this into a BLAST search page for me
AATCGAGTGGTTACCCTGCCTAGCAGCAGAGCAACTCACAGCGTGGCCAAGCGTGGCCAATCATCTATGCGATCATGCGATCAAACTCCAGCAGTACTGTGTACTGTCACCATTACTCAAACGAAGAATACAGCGACTCCAGGCGACGGAAACTGTGGGCAGTTGGCTAGCCAGCGCTAGCCAGCTGACGGTCCGAAAAGCCAGGGTAGACCCTTTTATGCCTGTTTATGCCTGTCCCACGCGGGAGAAGAAGTCATGCGGTTTCTTCAAATGGGAGCCCACAGCTATTACGTCCGATGGGATGGTCCCAAAACGAGACGCTGTGGACGCTGTGGTCTCTGTCGCAAGGA

Full Affymetrix probeset data:

Annotations for 1627866_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime