FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627867_at:

>probe:Drosophila_2:1627867_at:59:271; Interrogation_Position=195; Antisense; CATCCATTTGATTGAGCCGCTGAAG
>probe:Drosophila_2:1627867_at:3:549; Interrogation_Position=224; Antisense; GGAGGCCCTGGAACTATATCGTCAT
>probe:Drosophila_2:1627867_at:532:495; Interrogation_Position=244; Antisense; GTCATCGCCGTTTGCTACGAATTTA
>probe:Drosophila_2:1627867_at:307:231; Interrogation_Position=294; Antisense; AATGAACTGGCGTCTGGTTTGCTCC
>probe:Drosophila_2:1627867_at:145:481; Interrogation_Position=310; Antisense; GTTTGCTCCATTGTGACGATGGCCA
>probe:Drosophila_2:1627867_at:650:281; Interrogation_Position=361; Antisense; CTGCTCATTTGTGCCGTTCTAATTA
>probe:Drosophila_2:1627867_at:425:351; Interrogation_Position=386; Antisense; GCACTGGATTTTATATGAACCCCTT
>probe:Drosophila_2:1627867_at:644:341; Interrogation_Position=435; Antisense; GCTATTCGTTCTGGCATTCTGTATT
>probe:Drosophila_2:1627867_at:459:513; Interrogation_Position=512; Antisense; GTGTCTTCCTTGTCAGTGTAGTTAT
>probe:Drosophila_2:1627867_at:389:677; Interrogation_Position=530; Antisense; TAGTTATTTTGGTCATCTCCCACGT
>probe:Drosophila_2:1627867_at:34:605; Interrogation_Position=554; Antisense; TGTTGATCACCTACATCAGCTTCGA
>probe:Drosophila_2:1627867_at:599:35; Interrogation_Position=568; Antisense; ATCAGCTTCGAGTACCTGGTCAGAG
>probe:Drosophila_2:1627867_at:341:37; Interrogation_Position=601; Antisense; ATCTTGGTCGCCATAGTGCTCTATA
>probe:Drosophila_2:1627867_at:676:23; Interrogation_Position=623; Antisense; ATATCGCCTATATACTCTTCCTGAT

Paste this into a BLAST search page for me
CATCCATTTGATTGAGCCGCTGAAGGGAGGCCCTGGAACTATATCGTCATGTCATCGCCGTTTGCTACGAATTTAAATGAACTGGCGTCTGGTTTGCTCCGTTTGCTCCATTGTGACGATGGCCACTGCTCATTTGTGCCGTTCTAATTAGCACTGGATTTTATATGAACCCCTTGCTATTCGTTCTGGCATTCTGTATTGTGTCTTCCTTGTCAGTGTAGTTATTAGTTATTTTGGTCATCTCCCACGTTGTTGATCACCTACATCAGCTTCGAATCAGCTTCGAGTACCTGGTCAGAGATCTTGGTCGCCATAGTGCTCTATAATATCGCCTATATACTCTTCCTGAT

Full Affymetrix probeset data:

Annotations for 1627867_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720