FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627868_at:

>probe:Drosophila_2:1627868_at:22:193; Interrogation_Position=1568; Antisense; AACTAGCTAGGCATGTGGGCGCCGA
>probe:Drosophila_2:1627868_at:280:303; Interrogation_Position=1589; Antisense; CCGACAGTCTGGCTTATCTTAGTGT
>probe:Drosophila_2:1627868_at:668:437; Interrogation_Position=1627; Antisense; GAGGCTGTCCAACTAAAGCACCGCG
>probe:Drosophila_2:1627868_at:34:167; Interrogation_Position=1666; Antisense; AAATCCAAGGGAACGGGCCACTGCA
>probe:Drosophila_2:1627868_at:354:647; Interrogation_Position=1700; Antisense; TCACTGGTGAATATCCCGGTGGGCT
>probe:Drosophila_2:1627868_at:588:333; Interrogation_Position=1739; Antisense; GCTGGTGATACCGATTGAAGCTCAT
>probe:Drosophila_2:1627868_at:705:585; Interrogation_Position=1790; Antisense; TGGAAACCAGTTTTGCACGCAATTG
>probe:Drosophila_2:1627868_at:35:261; Interrogation_Position=1805; Antisense; CACGCAATTGCCCACTACGAAATAA
>probe:Drosophila_2:1627868_at:20:435; Interrogation_Position=1856; Antisense; GAGGGCTCGGAATTACTGTCACAAA
>probe:Drosophila_2:1627868_at:672:91; Interrogation_Position=1891; Antisense; AGTTTATCTAGCATTACAGCCCACC
>probe:Drosophila_2:1627868_at:103:273; Interrogation_Position=1916; Antisense; CATTCCTATTTACACTCTACCTTAT
>probe:Drosophila_2:1627868_at:662:303; Interrogation_Position=1987; Antisense; CCGATTTATGTCTGGTTTTGCCTCT
>probe:Drosophila_2:1627868_at:719:701; Interrogation_Position=2002; Antisense; TTTTGCCTCTGGAACTTTACTCATA
>probe:Drosophila_2:1627868_at:456:661; Interrogation_Position=2039; Antisense; TAACTCTTTGTTGCCCATCTTGAAT

Paste this into a BLAST search page for me
AACTAGCTAGGCATGTGGGCGCCGACCGACAGTCTGGCTTATCTTAGTGTGAGGCTGTCCAACTAAAGCACCGCGAAATCCAAGGGAACGGGCCACTGCATCACTGGTGAATATCCCGGTGGGCTGCTGGTGATACCGATTGAAGCTCATTGGAAACCAGTTTTGCACGCAATTGCACGCAATTGCCCACTACGAAATAAGAGGGCTCGGAATTACTGTCACAAAAGTTTATCTAGCATTACAGCCCACCCATTCCTATTTACACTCTACCTTATCCGATTTATGTCTGGTTTTGCCTCTTTTTGCCTCTGGAACTTTACTCATATAACTCTTTGTTGCCCATCTTGAAT

Full Affymetrix probeset data:

Annotations for 1627868_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720