FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627871_at:

>probe:Drosophila_2:1627871_at:635:193; Interrogation_Position=131; Antisense; AACTCTTGAGGGACACATGGAGCCA
>probe:Drosophila_2:1627871_at:83:605; Interrogation_Position=14; Antisense; TGATTCTGTCGGCTGTTCTGTTGCC
>probe:Drosophila_2:1627871_at:552:153; Interrogation_Position=145; Antisense; ACATGGAGCCAGTTCCTCCGCAGTT
>probe:Drosophila_2:1627871_at:357:633; Interrogation_Position=161; Antisense; TCCGCAGTTCCTCCGGATTGGTATG
>probe:Drosophila_2:1627871_at:135:667; Interrogation_Position=227; Antisense; TACAGACAGTCGAAGGGCAGGAGTT
>probe:Drosophila_2:1627871_at:156:77; Interrogation_Position=245; Antisense; AGGAGTTGACTTTGACCCTGACACC
>probe:Drosophila_2:1627871_at:82:613; Interrogation_Position=263; Antisense; TGACACCGCCTTTGGGAGATCCGAC
>probe:Drosophila_2:1627871_at:299:715; Interrogation_Position=310; Antisense; TTGAGGCCCTGTCCCTGCGGGAAAT
>probe:Drosophila_2:1627871_at:101:561; Interrogation_Position=329; Antisense; GGAAATCGCGGCGTCCTTCATCCTT
>probe:Drosophila_2:1627871_at:443:467; Interrogation_Position=33; Antisense; GTTGCCCAATTTCTGGCTGGTTCTT
>probe:Drosophila_2:1627871_at:416:711; Interrogation_Position=352; Antisense; TTCATCCTGCGTCCTATTACCACTG
>probe:Drosophila_2:1627871_at:343:287; Interrogation_Position=49; Antisense; CTGGTTCTTCTTGCTGTTTCTGTTT
>probe:Drosophila_2:1627871_at:318:269; Interrogation_Position=557; Antisense; CATCCCACAGAGAGTTTATCCCTTT
>probe:Drosophila_2:1627871_at:366:695; Interrogation_Position=65; Antisense; TTTCTGTTTTCGAACTGCAGTCAAA

Paste this into a BLAST search page for me
AACTCTTGAGGGACACATGGAGCCATGATTCTGTCGGCTGTTCTGTTGCCACATGGAGCCAGTTCCTCCGCAGTTTCCGCAGTTCCTCCGGATTGGTATGTACAGACAGTCGAAGGGCAGGAGTTAGGAGTTGACTTTGACCCTGACACCTGACACCGCCTTTGGGAGATCCGACTTGAGGCCCTGTCCCTGCGGGAAATGGAAATCGCGGCGTCCTTCATCCTTGTTGCCCAATTTCTGGCTGGTTCTTTTCATCCTGCGTCCTATTACCACTGCTGGTTCTTCTTGCTGTTTCTGTTTCATCCCACAGAGAGTTTATCCCTTTTTTCTGTTTTCGAACTGCAGTCAAA

Full Affymetrix probeset data:

Annotations for 1627871_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720