FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627872_at:

>probe:Drosophila_2:1627872_at:408:59; Interrogation_Position=1045; Antisense; ATGTTGGGTCTATTTCTGCATCCGA
>probe:Drosophila_2:1627872_at:323:67; Interrogation_Position=1074; Antisense; ATGGCGAGCGAACCGGATTCAACGT
>probe:Drosophila_2:1627872_at:166:463; Interrogation_Position=1089; Antisense; GATTCAACGTCTATGCGGCATGGAT
>probe:Drosophila_2:1627872_at:163:25; Interrogation_Position=1144; Antisense; ATAGGAGTTTCATTCTACTGCGGAA
>probe:Drosophila_2:1627872_at:217:1; Interrogation_Position=1175; Antisense; GGGTACTCCTAACATTTACTGCCGC
>probe:Drosophila_2:1627872_at:309:669; Interrogation_Position=1191; Antisense; TACTGCCGCCGGTATAAGCCTAAAG
>probe:Drosophila_2:1627872_at:78:569; Interrogation_Position=1215; Antisense; GGCAGAGTCTTCCAATATGCGAACT
>probe:Drosophila_2:1627872_at:565:177; Interrogation_Position=1270; Antisense; AAACTGGTCTGTATTCCGTAGCTGC
>probe:Drosophila_2:1627872_at:567:385; Interrogation_Position=1310; Antisense; GAACACTATCTGACTTGGAGCGAGC
>probe:Drosophila_2:1627872_at:53:555; Interrogation_Position=1326; Antisense; GGAGCGAGCATACTTAACTTCATTC
>probe:Drosophila_2:1627872_at:341:407; Interrogation_Position=857; Antisense; GACTGGCCACGGACAGTAGCGTTTA
>probe:Drosophila_2:1627872_at:576:361; Interrogation_Position=901; Antisense; GCAATGTTCTTCGTCATGCTGGGAT
>probe:Drosophila_2:1627872_at:506:49; Interrogation_Position=916; Antisense; ATGCTGGGATTTAGTCTACTCTCTG
>probe:Drosophila_2:1627872_at:476:279; Interrogation_Position=931; Antisense; CTACTCTCTGTAACGGTGATCCTGA

Paste this into a BLAST search page for me
ATGTTGGGTCTATTTCTGCATCCGAATGGCGAGCGAACCGGATTCAACGTGATTCAACGTCTATGCGGCATGGATATAGGAGTTTCATTCTACTGCGGAAGGGTACTCCTAACATTTACTGCCGCTACTGCCGCCGGTATAAGCCTAAAGGGCAGAGTCTTCCAATATGCGAACTAAACTGGTCTGTATTCCGTAGCTGCGAACACTATCTGACTTGGAGCGAGCGGAGCGAGCATACTTAACTTCATTCGACTGGCCACGGACAGTAGCGTTTAGCAATGTTCTTCGTCATGCTGGGATATGCTGGGATTTAGTCTACTCTCTGCTACTCTCTGTAACGGTGATCCTGA

Full Affymetrix probeset data:

Annotations for 1627872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720