FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627873_at:

>probe:Drosophila_2:1627873_at:182:597; Interrogation_Position=1003; Antisense; TGTGCACACTGCCATGACATTGGAG
>probe:Drosophila_2:1627873_at:110:597; Interrogation_Position=1036; Antisense; TGTGTGCTGCTACACATCGCAGACA
>probe:Drosophila_2:1627873_at:262:301; Interrogation_Position=1077; Antisense; CCCACGGCGGATACAAACACATTTT
>probe:Drosophila_2:1627873_at:293:83; Interrogation_Position=1110; Antisense; AGGGCAACACCAGCGTTGTGCGCGA
>probe:Drosophila_2:1627873_at:376:595; Interrogation_Position=1126; Antisense; TGTGCGCGAAATGTCCGTCTGGAAC
>probe:Drosophila_2:1627873_at:620:499; Interrogation_Position=1142; Antisense; GTCTGGAACGGCGTGTGCATTTCCC
>probe:Drosophila_2:1627873_at:353:609; Interrogation_Position=1170; Antisense; TGACCGCTGTCTACGAGAAGCCAAC
>probe:Drosophila_2:1627873_at:113:441; Interrogation_Position=1268; Antisense; GATGGCGCCGAGTAATACAGACCAA
>probe:Drosophila_2:1627873_at:396:513; Interrogation_Position=1308; Antisense; GTGTATTTAAATTCCCAACCCATGA
>probe:Drosophila_2:1627873_at:18:219; Interrogation_Position=1355; Antisense; AAGTATGGGTTCATCCTCACCAATA
>probe:Drosophila_2:1627873_at:403:717; Interrogation_Position=783; Antisense; TTCGCATTCTCAAGGATCTCACTAG
>probe:Drosophila_2:1627873_at:7:225; Interrogation_Position=794; Antisense; AAGGATCTCACTAGGCGTTTCGACG
>probe:Drosophila_2:1627873_at:57:287; Interrogation_Position=830; Antisense; CTGTCGGCCTGGATGCTGGACCTGA
>probe:Drosophila_2:1627873_at:599:605; Interrogation_Position=852; Antisense; TGATCGCCCATTTGGCCATCATGAA

Paste this into a BLAST search page for me
TGTGCACACTGCCATGACATTGGAGTGTGTGCTGCTACACATCGCAGACACCCACGGCGGATACAAACACATTTTAGGGCAACACCAGCGTTGTGCGCGATGTGCGCGAAATGTCCGTCTGGAACGTCTGGAACGGCGTGTGCATTTCCCTGACCGCTGTCTACGAGAAGCCAACGATGGCGCCGAGTAATACAGACCAAGTGTATTTAAATTCCCAACCCATGAAAGTATGGGTTCATCCTCACCAATATTCGCATTCTCAAGGATCTCACTAGAAGGATCTCACTAGGCGTTTCGACGCTGTCGGCCTGGATGCTGGACCTGATGATCGCCCATTTGGCCATCATGAA

Full Affymetrix probeset data:

Annotations for 1627873_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720